Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis

Plant Breeding and Biotechnology 2017;5(3):243-251.
Published online: September 1, 2017

1Department of Plant Science, Plant Genomics and Breeding Institute, and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea

2Phyzen Genomics Institute, Seongnam 13558, Korea

3Il Song ERT. Co. LTD, Yongin 16950, Korea

*Corresponding author: Sang-Choon Lee, sclee0923@snu.ac.kr, Tel: +82-2-880-4557, Fax: +82-2-873-2056, Tae-Jin Yang, tjyang@snu.ac.kr, Tel: +82-2-880-4547, Fax: +82-2-873-2056
• Received: August 19, 2017   • Revised: August 19, 2017   • Accepted: August 19, 2017

Copyright © 2017 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 215 Views
  • 0 Download
  • 5 Crossref
prev

Citations

Citations to this article as recorded by  Crossref logo
  • Complete plastid and 45S rDNA sequences allow authentication of Liriope platyphylla and Ophiopogon japonicus
    Yeonjeong Lee, Hyun-Seung Park, Jae-Hyeon Jeon, Jee Young Park, Seung Hyun Kim, Jungmoo Huh, Sunmin Woo, Do-Won Jeong, Tae-Jin Yang
    Current Plant Biology.2022; 30: 100244.     CrossRef
  • Variation among the Complete Chloroplast Genomes of the Sumac Species Rhus chinensis: Reannotation and Comparative Analysis
    Yujie Xu, Jun Wen, Xu Su, Zhumei Ren
    Genes.2022; 13(11): 1936.     CrossRef
  • Phytochemical, Antioxidant, Anti-Microbial, and Pharmaceutical Properties of Sumac (Rhus coriaria L.) and Its Genetic Diversity
    Anna Perrone, Sanaz Yousefi, Boris Basile, Giandomenico Corrado, Antonio Giovino, Seyed Alireza Salami, Alessio Papini, Federico Martinelli
    Horticulturae.2022; 8(12): 1168.     CrossRef
  • Authentication of Rubus coreanus and Related Species via DNA Barcoding and HPLC Approaches
    Young Sang Park, Young Jun Kim, Tae Jin Yang, Ji Yeon Kim
    Korean Journal of Medicinal Crop Science.2021; 29(6): 425.     CrossRef
  • Plastid genomes of the North American Rhus integrifolia-ovata complex and phylogenomic implications of inverted repeat structural evolution in Rhus L.
    Craig F. Barrett
    PeerJ.2020; 8: e9315.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis
Plant Breed. Biotech.. 2017;5(3):243-251.   Published online September 1, 2017
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis
Plant Breed. Biotech.. 2017;5(3):243-251.   Published online September 1, 2017
Close

Figure

  • 0
  • 1
  • 2
  • 3
The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis
Image Image Image Image
Fig. 1 Chloroplast genome map of R. chinensis and intra-species polymorphic DNA markers. (a) Chloroplast genome map of R. chinensis generated using OGDRAW (http://ogdraw.mpimp-golm.mpg.de/). Genes transcribed clockwise and counterclockwise are indicated on the outside and inside of the large circle, respectively. The four parts of the chloroplast genome and GC content are indicated on the inner circle. Red and blue bars in the inner circle indicate intra-species InDels and SNPs identified between Chinese and Korean R. chinensis chloroplast genome sequences. Black arrows represent the target regions for InDel markers and the purple arrow indicates SNP used to differentiate between Chinese and Korean R. chinensis.
Fig. 2 Phylogenetic analysis of R. chinensis. The tree was generated with complete chloroplast genome sequences of R. chinensis and species belonging to the Sapindales order by multiple alignment using MAFFT (http://mafft.cbrc.jp/alignment/server/index.html) and a maximum likelihood (ML) analysis using MEGA 6.0 (Tamura et al. 2013). Numbers in the nodes are bootstrap support values (>50%) from 1000 replicates. Chloroplast genome sequences used for this tree are: Acer burgerianum ssp. ningpoense, KF753631; Acer davidii, NC_030331; Acer miaotaiense, NC_030343; Azadirachta indica, NC_023792; Boswellia sacra, KT934315; Citrus aurantiifolia, KJ865401; Citrus sinensis, DQ864733; Dipteronia sinensis, NC_029338; R. chinensis (China), MF351625; R. chinensis (Korea), NC_033535; Sapindus mukorossi, KM454982; Spondias bahiensis, KU756561; Spondias tuberosa, KU756562.
Fig. 3 Two InDel-based markers to validate intra-species diversity in R. chinensis. (a) A 39-bp InDel in trnS-GGA-rps4 and (c) its PCR products (Marker rh_InDel_02 in Table 4) for eight R. chinensis plants. (b) 25-bp InDel in ycf1 and (d) its PCR products (Marker rh_InDel_03 in Table 4) for eight R. chinensis plants. R. chinensis collections 1: China (Shandong and Henan), 2: Korea (Yang-gu), 3: Korea (Hwacheon), 4: Korea (Mt. Jiri), 5: Korea (Han-taek Botanical Garden), 6: Korea (Mt. Kariwang), 7, 8: Korea (Gwangreung Botanical Garden), M: 100-bp DNA ladder.
Fig. 4 SNP-based marker to validate intra-species diversity in R. chinensis. (a) Alignment of nucleotide sequences to show the SNP (arrow) in ycf1 gene of chloroplast of Korean and Chinese R. chinensis plants. (b) Agarose gel electrophoresis of the PCR products amplified by Marker rh_hrm_11 (Table 4). (c) HRM analysis of the PCR products to detect the SNP. R. chinensis collections 1: China (Shandong and Henan), 2: Korea (Yang-gu), 3: Korea (Hwacheon), 4: Korea (Mt. Jiri), 5: Korea (Han-taek Botanical Garden), 6: Korea (Mt. Kariwang), 7, 8: Korea (Gwangreung Botanical Garden), M: 100-bp DNA ladder.
The Complete Chloroplast Genome Sequence and Intra-Species Diversity of Rhus chinensis

Sample collections of R. chinensis used in this study.

Accession nos. Countries Collected locations Collected year
1 China Shandong and Henan provinces 2014
2 Korea Yang-gu, Gangwon-do 2014
3 Korea Hwacheon, Gangwon-do 2014
4 Korea Mt.Jiri, Sancheong, Kyungsangnam-do, 2014
5 Korea Han-taek Botanical Garden, Yong-in, Kyungki-do 2015
6 Korea Mt. Kariwang, Jeong-seon, Gangwon-do 2015
7 Korea Gwangreung Botanical Garden, Korea National Arboretum, Po-cheon, Gyeonggi-do 2015
8 Korea Gwangreung Botanical Garden, Korea National Arboretum, Po-cheon, Gyeonggi-do 2015

Summary of NGS data and chloroplast genomes of two Rhus chinensis collections.

Collected locations Raw data bases (bp) Cp genome coverage (x) Cp length (bp) LSC length (bp) IR length (bp) SSC length (bp)
China 4,199,252,923 162 149,094 97,246 16,602 18,644
Korea (Yang-gu)z) 6,251,344,649 96 149,011 96,882 16,741 18,647

z)reported by Lee et al. (2016).

Genes annotated in R. chinensis chloroplast genome.

Gene types Gene names
Photosystem I psaA, B, C, I, J
Photosystem II psbA, B, C, D, E, F, H, I, J, K, L, M, N, T, Z
Cytochrome b/f complex petA, B, D, G, N, L
ATP synthase atpA, B, E, F, H, I
NADH dehydrogenase ndhA, B, C, D, E, F, G, H, I, J, K
RubisCO large subunit rbcL
RNA polymerase rpoA, B, C1, C2
Ribosomal proteins (SSU) rps2, 3, 4, 7, 8, 11, 12, 14, 15, 16, 18
Ribosomal proteins (LSU) rpl2, 14, 16, 20, 23, 32, 33, 36
clpP, matK clpP, matK
Other genes ccsA, cemA, accD
Hypothetical chloroplast reading frames ycf1, 2, 3, 4, 15
Transfer RNAs trnfM-CAU, A-UGC, C-GCA, D-GUC, E-UUC, F-GAA, G-GCC,UCC, H-GUC, I-CAU,GAU, K-UUU, L-CAA,CAU,UAG,UAA, M-CAU, N-GUU, P-UGG, Q-UUG, R-UCU, ACG, S-UGA,GCU,GGA, T-GGU, V-GAC,UAC, W-CCA, Y-GUA
Ribosomal RNAs rrn4.5, 5, 16, 23

Molecular markers developed in this study.

Type Marker Name Target Region Primer Sequence Variation Product Size (bp)
InDel rh_InDel_02 trnS-GGA-rps4 F AGTGGTTCAAGGCGTAGCAT 39 bp 288/249
R ATTTGATCCGGCGATTTGGA
rh_InDel_03 ycf1 F TGATTCGCTCGATTTCGCCA 25 bp 221/196
R TCTGTCCTTCAATATCACGGAAC
SNP rh_hrm_11 ycf1 F CATGTGTGCATCTCTGGGTT G/T 191
R CTTCCTTTGGTCCAATTCTCGAT
Table 1 Sample collections of R. chinensis used in this study.
Table 2 Summary of NGS data and chloroplast genomes of two Rhus chinensis collections.

reported by Lee et al. (2016).

Table 3 Genes annotated in R. chinensis chloroplast genome.
Table 4 Molecular markers developed in this study.