Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng

Plant Breeding and Biotechnology 2018;6(1):74-81.
Published online: March 1, 2018

1Chromosome Research Institute, Department of Life Science, Sahmyook University, Seoul 01795, Korea

2Department of Plant Science, Plant Genomics and Breeding Institute, and Research Institute of Agriculture and Life Sciences, College of Agriculture and Life Sciences, Seoul National University, Seoul 08826, Korea

*Corresponding author Hyun Hee Kim, kimhh@syu.ac.kr, Tel: +82-2-3399-1715, Fax: +82-2-3399-1729
*Corresponding author Tae-Jin Yang, tjyang@snu.ac.kr, Tel: +82-2-880-4547, Fax: +82-2-8873-2056
• Received: February 14, 2018   • Revised: February 20, 2018   • Accepted: February 20, 2018

Copyright © 2018 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 309 Views
  • 0 Download
  • 11 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Beyond genome: Advanced omics progress of Panax ginseng
    Wenjing Yu, Siyuan Cai, Jiali Zhao, Shuhan Hu, Chen Zang, Jiang Xu, Lianghai Hu
    Plant Science.2024; 341: 112022.     CrossRef
  • Identification and functional analysis of COLD-signaling-related genes in Panax ginseng
    Jeongeui Hong, Hojin Ryu
    Journal of Plant Biotechnology.2023;[Epub]     CrossRef
  • Cell cycle synchronization in Panax ginseng roots for cytogenomics research
    Eliazar Alumbro Peniton, Nomar Espinosa Waminal, Tae-Jin Yang, Hyun Hee Kim
    Horticulture, Environment, and Biotechnology.2022; 63(1): 137.     CrossRef
  • Gibberellin Signaling Promotes the Secondary Growth of Storage Roots in Panax ginseng
    Chang Pyo Hong, Jinsoo Kim, Jinsu Lee, Seung-il Yoo, Wonsil Bae, Kyoung Rok Geem, Jin Yu, Inbae Jang, Ick Hyun Jo, Hyunwoo Cho, Donghwan Shim, Hojin Ryu
    International Journal of Molecular Sciences.2021; 22(16): 8694.     CrossRef
  • Functional characterization of gibberellin signaling-related genes in Panax ginseng
    Jinsoo Kim, Woo-Ri Shin, Yang-Hoon Kim, Donghwan Shim, Hojin Ryu
    Journal of Plant Biotechnology.2021; 48(3): 148.     CrossRef
  • Interstitial Telomeric-like Repeats (ITR) in Seed Plants as Assessed by Molecular Cytogenetic Techniques: A Review
    Alexis J. Maravilla, Marcela Rosato, Josep A. Rosselló
    Plants.2021; 10(11): 2541.     CrossRef
  • FISH Karyotype Comparison ofPlatycodon grandiflorus(Jacq.) A. DC. ‘Jangbaek’ and Its Colchicine-Induced Tetraploid ‘Etteumbaek
    Eliazar Alumbro Peniton Jr., Yurry Um, Hyun Hee Kim
    Plant Breeding and Biotechnology.2020; 8(4): 389.     CrossRef
  • Five-color fluorescence in situ hybridization system for karyotyping of Panax ginseng
    Nomar Espinosa Waminal, Tae-Jin Yang, Jun-Gyo In, Hyun Hee Kim
    Horticulture, Environment, and Biotechnology.2020; 61(5): 869.     CrossRef
  • FISH Karyotype Comparison between Wild and CultivatedPerillaSpecies Using 5S and 45S rDNA Probes
    Eliazar Alumbro Peniton, Nomar Espinosa Waminal, Tae-Ho Kim, Hyun Hee Kim
    Plant Breeding and Biotechnology.2019; 7(3): 237.     CrossRef
  • Rapid and Efficient FISH using Pre-Labeled Oligomer Probes
    Nomar Espinosa Waminal, Remnyl Joyce Pellerin, Nam-Soo Kim, Murukarthick Jayakodi, Jee Young Park, Tae-Jin Yang, Hyun Hee Kim
    Scientific Reports.2018;[Epub]     CrossRef
  • Identification of ABSCISIC ACID (ABA) signaling related genes in Panax ginseng
    Jeongeui Hong, Hogyum Kim, Hojin Ryu
    Journal of Plant Biotechnology.2018; 45(4): 306.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng
Plant Breed. Biotech.. 2018;6(1):74-81.   Published online March 1, 2018
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng
Plant Breed. Biotech.. 2018;6(1):74-81.   Published online March 1, 2018
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng
Image Image Image Image Image
Fig. 1 Diagram in identifying repeats in P. ginseng. (A) A general non-comprehensive scheme of different applications for NGS data. Following this scheme, we used 0.3× of P. ginseng Illumina reads for tandem repeat analysis in this study. (B) A simple workflow for quantifying micro- and minisatellites.
Fig. 2 FISH analysis of PgGA15 on P. ginseng chromosomes. (A–C) Raw images of DAPI stained chromosomes, PgGA15, and Pg167TR signals, respectively. (D and E) Pseudo-colored images of PgGA15 signal and Pg167TR. The PgGA15 signal was localized on the long arm of chromosome 20. (F) Merged images of PgGA15 (arrowheads) and Pg167TR signals. Bar = 10 μm.
Fig. 3 FISH analysis of PgTel on P. ginseng (A–C) and P. quinquefolius (D–F) chromosomes. (A, B and D, E) Raw images of DAPI stained chromosomes and PgTel signals, respectively. (C and F) Merged images from A, B and D, E. PgTel localized in every chromosome termini with an additional location in one chromosome in both P. ginseng and P. quinquefolius (arrowheads). Based on previous karyotype of P. ginseng, the interstitial PgTel localized in the long arm of chromosome 10, but in P. quinquefolius, no established karyotype has been reported yet. Bars = 10 μm.
Fig. 4 FISH analysis of Pgms1 and Pg167TR on P. ginseng chromosomes. (A–C) Raw images of Pgms1, Pg167TR, and DAPI stained chromosomes, respectively. (D–F) Pseudo-colored signals from A–C, respectively, indicating the localization of Pgms1 on the long arm of chromosome 1. (F) Merged images of Pgms1 (arrowheads) and Pg167TR. Bar = 10 μm.
Fig. 5 Karyotype idiogram of P. ginseng showing different cytogenetic markers. Navy blue, orange, red, and green bands represent DAPI, Pg167TR, 45S rDNA, and 5S rDNA as described in Waminal et al. (2017). The DAPI bands in the long arm of chromosomes 1 and 20 are the sites for Pgms1 (patterned arrowhead) and PgGA15 (grey arrowhead) tandem repeats, respectively. PgTel repeats are depicted by magenta circles. An interstitial PgTel locus localized in the intense DAPI band in the long arm of chromosome 10 (green arrowhead).
Characterization of Chromosome-Specific Microsatellite Repeats and Telomere Repeats Based on Low Coverage Whole Genome Sequence Reads in Panax ginseng

List of tandem repeats >25 kb identified in P. ginseng concatenated Illumina reads.

No. Sequence Period size (base) %AT Total repeat units GRz) Ave. repeat/ locus Total repeat loci Total bases Given name in this study Chromosomal distribution
1 (TA)n 2 100 44,836 0.032 11.8 3,790 89,187 -- None detected
2 (TAT)n 3 100 28,869 0.031 9.3 3,091 86,167 -- None detected
3 (GA)n 2 50 16,347 0.012 9.3 1,762 32,591 PgGA15 DAPI band on long arm of Chr. 20
4 (TG)n 2 50 13,464 0.010 9.3 1,446 26,890 -- None detected
5 (TCT)n 3 67 8,370 0.009 6.7 1,252 25,204 -- None detected
6 (TTTAGGG)n 7 57 6,527 0.016 11.9 550 45,675 PgTel Chromosome termini and DAPI band on long arm of Chr. 10
7 (ACATTCTTGAT)n 11 73 5,427 0.021 8.7 627 58,266 Pgms1 DAPI band on long arm or Chr. 1

z)Genome representation.

List of oligonucleotide probes used for FISH.

 No.  Name Sequence Length Used label
1 PgGA15_OP  GAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 30 bases 5′-FAM
3 PgTel_OP TTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGG  34 bases 5′-Cy3
2 Pgms1_OP ACATTCTTGATACATTCTTGATACATTCTT 30 bases 5′-Cy3
Table 1 List of tandem repeats >25 kb identified in P. ginseng concatenated Illumina reads.

Genome representation.

Table 2 List of oligonucleotide probes used for FISH.