Abstract
During seed production of onion (Allium cepa L.) and Welsh onion (A. fistulosum L.) cultivars, seeds are inadvertently cross-contaminated with each other. However, it is difficult to identify cross-contaminated seeds by visual examination since seed and seedling morphologies of onion and Welsh onion are almost identical. To develop molecular markers for distinguishing onion and Welsh onion at early seedling stages, polymorphic mitochondrial genome sequences between two species were isolated. Using complete mitochondrial genome sequences of onions as references, genome walking was performed to isolate polymorphic Welsh onion sequences. Unlike conserved 3′ sequences flanking the atp9 gene, the 5′ flanking sequences were completely different between onion and Welsh onion mitochondrial genomes. A simple PCR marker was developed on the basis of polymorphic 5′ flanking regions of atp9, and a high resolution melting (HRM) marker was developed based on one of single nucleotide polymorphisms (SNPs) in the 3′ flanking regions. A total of 41 onion and 19 Welsh onion cultivars were analyzed using these two molecular markers. Results showed that the onion-specific marker genotype was detected only in onion cultivars, and vice versa. To estimate distribution of onion-specific and Welsh onion-specific organizations of atp9 among Allium species, 14 Allium species related to onion and Welsh onion were analyzed. Results showed that specific organizations were conserved among closely related species of onion and Welsh onion, respectively, implying that there might be no intraspecific variation in the atp9 organizations.
-
Key words: Onion (Allium cepa L.), Welsh onions (Allium fistulosum L.), Molecular marker, High resolution melting (HRM), Seed quality control
INTRODUCTION
The genus
Allium consists of more than 700 species. Among them, approximately 20 species have been cultivated for foods and medicinal plants (
Friesen and Klaas 1998;
van Raamsdonk et al. 2003). Onion (
Allium cepa L.) is the second most important vegetable in the world following tomato (
Griffiths et al. 2002). Welsh onion (
A. fistulosum L.) is an important vegetable in East Asian countries such as Korea, Japan, and China (
Brewster 2008).
CMS in onions is relatively well characterized compared to Welsh onions. Two kinds of CMS (CMS-S and CMS-T) have been reported in the previous studies (
Jones and Emsweller 1936;
Jones and Clarke 1943;
Berninger 1965;
Schweisguth 1973). Almost complete mitochondrial genome sequences of normal, CMS-S, and CMS-T cytoplasms have recently been reported (
Kim et al. 2016,
2019). A chimeric gene,
orf725 was suggested to be a causal gene for CMS in both CMS-S and CMS-T cytoplasms. Compared with normal male-fertile cytoplasm, CMS-S mitochondrial genome was highly variable, and many polymorphisms have been found (
Kim et al. 2016). Meanwhile, there were only three single nucleotide polymorphisms (SNPs) between normal and CMS-T mitochondrial genome sequences, except for
orf725 which was detected only in the CMS-T cytoplasm (
Kim et al. 2019).
One type of CMS was discovered from Welsh onion accessions (
Moue and Uehara 1985), but this CMS has not been widely used in F
1 hybrid breeding due to susceptibility to several diseases (
Yamashita et al. 2010). Another type of CMS has been produced by introduction of cytoplasm of
A. galanthum (
Yamashita et al. 1999). However, molecular genetic information about mitochondrial genome sequences and CMS-inducing genes are very limited in Welsh onions.
Using well characterized onion mitochondrial genome sequences, polymorphic organizations between onion and Welsh onion mitochondrial genomes were identified in this study to develop molecular markers for distinguishing onion and Welsh onion at early seedling stages. Since seed and seedling morphologies of onion and Welsh onion are hard to distinguish by visual examination, molecular markers for distinguishing two species are required to identify cross-contaminated seeds of onion or Welsh onion cultivars during the quality control process of harvested seeds. However, no report on development of such molecular markers for distinction of onion and Welsh onion has been published yet. Cross-contamination of seeds of onion and Welsh onion sometimes occurs during harvesting seeds in the fields and cleaning harvested seeds at seed conditioning facilities.
MATERIALS AND METHODS
Plant materials and total genomic DNA extraction
A male-fertile (2702B) and a male-sterile (2702A) Welsh onion breeding lines were used to identify polymorphic mitochondrial genome organizations between onions and Welsh onions. A cetyl trimethylammonium bromide (CTAB) method (
Doyle and Doyle 1987) was used to extract total genomic DNAs from leaf tissues of two breeding lines after male-fertility phenotypes had been confirmed. A total of 41 onion and 19 Welsh onion cultivars were used to validate reliability of molecular markers developed in this study. Lists of onion and Welsh onion cultivars analyzed in this study are shown in
Supplementary Tables S1 and
S2, respectively. Total genomic DNAs were extracted from seedlings of three-to-four leaf stages using a CTAB method. A total of 14
Allium species closely related to onion and Welsh onion were used to estimate distribution of specific
atp9 organizations. A list of these
Allium species is shown in
Supplementary Table S3. One accession for each
Allium species was used. Total genomic DNAs extracted by a previous study (
Kim 2013) were used.
Identification of conserved mitochondrial genomic regions among three onion cytoplasm types
To identify conserved syntenic blocks among three onion mitochondrial genomes, complete mitochondrial genome sequences produced in the previous studies (
Kim et al. 2016,
2019) were used. A single circular sequence of CMS-S (GenBank accession: KU318712) and four scaffold sequences of normal mitochondrial genome (GenBank accessions MH548362-MH548365) were compared. In the case of CMS-T whose mitochondrial genome sequences were almost identical to those of normal cytoplasm, additional organization flanking
orf725 depicted by
Kim et al. (2019) was used for comparison.
Genome walking and sequencing of PCR products
Genome walking was performed to obtain flanking sequences of atp9 of both male-fertile and male-sterile Welsh onion breeding lines (2702B and 2702A) using a Universal GenomeWalker kit (Clontech, Palo Alto, CA, USA) according to the manufacturer’s instruction. PCR products of genome walking were visualized on 1.5% agarose gels after ethidium bromide staining. Next, PCR products were purified using a QIAquick PCR Purification kit (QIAGEN, Valencia, CA, USA). Sequencing of PCR products was performed by a specialized company (Macrogen, Seoul, Republic of Korea).
Analysis of molecular markers using simple PCR amplification and high resolution melting (HRM) analysis
For analysis of a simple PCR marker, PCR amplification was performed in a 10 μL reaction mixture containing 0.05 μg template, 1.0 μL 10× PCR buffer, 0.2 μL of two forward primers, M1-F1 and M1-F2 (10 μM), 0.2 μL reverse primer, M1-R1 (10 μM), 0.2 μL dNTPs (10 mM each), and 0.25 U
Taq DNA polymerase (Prime Tag DNA polymerase; GeNet Bio, Nonsan, Republic of Korea). Primer sequences are shown in
Table 1. PCR amplification procedure consisted of an initial denaturation step at 95°C for 5 minutes; 40 cycles at 95°C for 30 seconds, 65°C for 30 seconds, and 72°C for 1 minute, and a final 10 minute extension step at 72°C. PCR products were visualized on 1.5% agarose gels after ethidium bromide staining.
For analysis of an HRM marker, HRM analysis was performed in 20-μL reaction mixture containing 0.05 μg template, 2.0 μL 10× PCR buffer, 1.0 μL forward primer (10 μM), 1.0 μL reverse primer (10 μM), 1.0 μL dNTPs (10 mM each), 0.25 U Taq polymerase (Prime Tag DNA polymerase; GeNet Bio), and 1.0 μL 100-fold diluted SYTO
®9 green fluorescent nucleic acid stain (Thermo Fisher Scientific, Waltham, MA, USA). Primer sequences are shown in
Table 1.
PCR amplification was carried out with a condition consisting of an initial denaturation step at 95°C for 10 minutes and 45 cycles at 95°C for 10 seconds, 60°C for 5 seconds, and 72°C for 5 seconds. Next, PCR products were heated to 95°C with a ramp rate of 4.4°C/s, cooled to 40°C with a ramp rate of 2.2°C/s, and heated again to 65°C with a ramp rate of 2.2°C/s. Normalized HRM curves and peaks were obtained with a LightCycler® 96 system (Roche Molecular Systems, Pleasanton, CA, USA) by melting from 65 to 97°C at a rate of 0.07°C/s.
Construction of phylogenetic trees
Nucleotide sequences of
atp9 and its 3′ flanking regions of three onions (normal, CMS-T, and CMS-S) and two Welsh onion breeding lines (2702B and 2702A) were used to estimate phylogenetic relationship of these sequences. Onion sequences were obtained from complete mitochondrial genome sequences (
Kim et al. 2016,
2019). To construct a phylogenetic tree of 16
Allium species, chloroplast sequences between
rps16 and
trnQ were used. These chloroplast sequences of 16
Allium species were obtained from a previous study (
Kim 2013). In both cases of mitochondrial and chloroplast genome sequences, nucleotide sequences were aligned using BioEdit software (
Hall 1999). Gaps in the alignment were removed using Gblocks software (
Castresana 2000). Phylogenetic trees were constructed using MEGA version 7 (
Kumar et al. 2016) with a neighbor-joining method. Node support of the phylogenetic tree was assessed by 1,000 bootstrap replicates.
RESULTS
Identification of onion-specific and welsh onion-specific regions in mitochondrial genome sequences
During the process of seed production of cultivars, seeds of onion and Welsh onion are sometimes mixed with each other. However, contaminated seeds cannot be distinguished by morphological difference. Seed morphologies of onion and Welsh onions were almost indistinguishable by visual examination (
Fig. 1A, 1C). Furthermore, it was difficult to distinguish onions and Welsh onions based on morphologies of cotyledons (
Fig. 1B, 1D). Therefore, molecular markers for distinguishing onion and Welsh onion at early seedling stages would be useful to test whether onion or Welsh onion seeds are contaminated with each other and to estimate proportions of contamination in seeds which are sampled for quality control.
For universal application of molecular markers to all onion and Welsh onion cultivars, differential regions in mitochondrial genomes were selected as target sequences for development of molecular markers. Complete onion mitochondrial genome sequences of normal (339,180 bp), CMS-T (359,188 bp), and CMS-S (316,363 bp) cytoplasms (
Kim et al. 2016,
2019) were compared to screen the genes whose 5′ and 3′ flanking sequences were conserved among three onion mitochondrial genomes. Among them, the
atp9 gene was selected as a target gene for marker development, since flanking regions of
atp9 was prone to be involved in frequent mtDNA rearrangements. For an example, partial sequences of
atp9 was involved in creation of a chimeric gene,
orf725 in onions (
Kim et al. 2009).
Genome walking was performed to isolate flanking sequences of
atp9 in mitochondrial genomes of Welsh onions. From a male-fertile Welsh onion, 527-bp 5′ and 755-bp 3′ flanking sequences were obtained (
Fig. 2). Although 3′ flanking sequences of onions and Welsh onions showed more than 98% nucleotide sequence identity, the 5′ flanking sequences were completely different between onions and Welsh onions (
Fig. 2). The partial (485 bp) sequences covering the 5′ flanking region of Welsh onion
atp9 were identified from onion mitochondrial genome of the CMS-S cytoplasm. Although this 485-bp region showed 100% nucleotide sequence identity with corresponding onion sequences, this region was separated from
atp9 with a distance of 152,572 bp in onion mitochondrial genome of the CMS-S cytoplasm (GenBank accession: KU318712).
Based on the flanking sequences of
atp9 in a male-fertile Welsh onion, homologous sequences were isolated from a male-sterile Welsh onion. The organization was identical to that of the male-fertile Welsh onion, but there were two SNPs and one 2-bp InDel between male-fertile and male-sterile Welsh onions. In the case of onions, sequences flanking
atp9 were identical between normal and CMS-T cytoplasms, but there were two SNPs in the 5′ flanking region between normal and CMS-S cytoplasms. When onion and Welsh onion sequences were compared, there were six SNPs and two InDels, implying that interspecific genetic distances between onion and Welsh onions were longer than intraspecific distances (
Fig. 3).
Development of molecular markers for distinguishing onion and Welsh onion
To develop a simple PCR marker, a common reverse primer (M1-R1) was designed on the
atp9 coding sequences, and one Welsh onion-specific forward primer (M1-F1) and another onion-specific forward primer (M1-F2) were designed on the unique regions, respectively (
Fig. 2). Single PCR products with expected sizes were amplified in both onions and Welsh onions when PCR amplifications were performed using a combination of three primers (
Fig. 4A). In addition, an optimal HRM marker was designed using one of the SNPs between onion and Welsh onion in the 3′ flanking region of
atp9 (
Fig. 2). Normalized melting curves and peaks of onion and Welsh onions were clearly separated (
Fig. 4B). To validate applicability of simple PCR and HRM markers, 41 onion and 19 Welsh onion cultivars were tested using these two molecular markers. As expected, onion-specific PCR products and HRM peaks were observed in all tested onion cultivars (
Supplementary Table S1). Likewise, marker types specific to Welsh onion were detected only in Welsh onion cultivars (
Supplementary Table S2).
Distribution of onion and Welsh onion-specific sequences flanking the atp9 gene in closely related Allium species
To ascertain the time when rearrangements in the 5′ flanking regions of
atp9 have been arisen in onion or Welsh onion mitochondrial genomes, 14
Allium species related with onion and Welsh onion were analyzed with the simple PCR marker. The onion-specific PCR products were amplified in five (
A. praemixtum,
A. vavilovii,
A. dictyoprasum,
A. roylei, and
A. galanthum) closely related
Allium species, while Welsh onion-specific PCR products were amplified in three (
A. altaicum,
A. ledebourianum, and
A. schoenoprasum) closely related
Allium species (
Fig. 5). In the case of relatively distantly related species, PCR products were generally not as intense as closely related species due to possible mismatches on primer-binding sites (
Fig. 5B), and even no PCR product could be amplified in
A. amphibolum. Despite low efficiency of PCR amplification, the onion-specific PCR product was observed in
A. saxatile, but the Welsh onion-specific PCR products were amplified in
A. hymenorrhizum and
A. oreoprasum. Interestingly, both onion-specific and Welsh onion-specific PCR products were identified in
A. bidentatum and
A. splendens (
Fig. 5B). These results implied that both onion-specific and Welsh onion-specific organizations of
atp9 might have existed in common ancestors of these related
Allium species.
DISCUSSION
Development of reliable molecular markers for distinguishing onion and Welsh onion based on polymorphic mitochondrial genome sequences
Polymorphisms in mitochondrial genome sequences were used to develop molecular markers for distinguishing onion and Welsh onion in this study. Since nuclear genome sequences are assumed to be highly variable depending on accessions and cultivars, it might be difficult to develop molecular markers which can be applied to all varieties. Therefore, mitochondrial or chloroplast genomes are likely to be suitable for development of universal markers. Complete chloroplast and mitochondrial genome sequences of normal, CMS-T, and CMS-S cytoplasms of onions were reported in our previous studies (
Kim et al. 2015,
2016,
2019).
Compared with highly variable mitochondrial genomes, the content and organization of genes were conserved among three onion chloroplast genomes (
Kim et al. 2015). In contrast, organizations of normal and CMS-S mitochondrial genomes were highly rearranged with 31 syntenic blocks (
Kim et al. 2019). Therefore, mitochondrial genomes were selected to develop a simple PCR marker of which genotypes could be analyzed using agarose gels without expensive equipment. In addition, the SNP positioned on the 3′ region of
atp9 was used to develop an HRM marker optimal for high-throughput analysis.
To estimate the time when rearrangements in the 5′ region of
atp9 have occurred, 14
Allium species relatively closely related to onion and Welsh onion were analyzed using the simple PCR marker developed in this study (
Fig. 5). Onion-specific and Welsh onion-specific PCR products were amplified in five and four
Allium species which were closely related to onion and Welsh onion, respectively. However, both onion-specific and Welsh onion-specific PCR products were detected among four relatively distantly related
Allium species.
It is hypothesized that both onion-specific and Welsh onion-specific organizations of
atp9 might have existed in common ancestors of these 14
Allium species. ‘Heteroplasmy’, defined as presence of more than one type of mitochondrial genomes in an organism is considered to be a common state of plant mitochondrial genomes (
Kmiec et al. 2006;
Gualberto and Newton 2017). However, during divergence of
Allium species, the onion-specific organization is assumed to be predominant in onions and five related species. A similar phenomenon might occur in Welsh onion and three related species. Since the onionspecific organization was observed in normal and CMS-S cytoplasms of onions and even in five related
Allium species, the Welsh onion-specific PCR products may not be amplified in any onion varieties, indicating high reliability of molecular markers developed in this study. In fact, no Welsh onion-specific PCR products were amplified in all tested onion cultivars in this study.
Application of molecular markers for distinguishing onion and Welsh onion in seed production of onion and Welsh onion cultivars
Since seed and seedling morphologies of onion and Welsh onion are almost indistinguishable by visual examination (
Fig. 1), cross-contaminated seeds cannot be identified during seed production of onion and Welsh onion cultivars. Cross-contamination of seeds might happen at two stages of seed production. First, seeds can be contaminated during harvest in seed production fields if onion and Welsh onion fields are closely located. Second, seeds can be inadvertently introduced during cleaning and conditioning of harvested seeds at seed conditioning facilities. Unless seeds are completely removed from a series of equipment at seed conditioning factories, cross-contamination is inevitable. Therefore, molecular markers developed in this study can be efficiently used to detect cross-contaminated seeds during quality control process.
Although all tested onion and Welsh onion cultivars contained their own cytoplasms in this study, some onion or Welsh onion accessions have been produced by inter-specific crosses between different
Allium species. For examples, onion accessions resistant to downy mildew have been produced by interspecific crosses between onion and
A. roylei (
Kofoet et al. 1990;
van der Meer and de Vries 1990). In addition, CMS Welsh onions have been produced by interspecific crosses between
A. galanthum and Welsh onions (
Yamashita et al. 1999). Since hybrid plants are known to be produced between onions and other
Allium species such as
A. galanthum,
A. fistulosum,
A. vavilovii, and
A. roylei (
van Raamsdonk et al. 2003), supplementary molecular markers for detecting such interspecific hybrids are required to be developed in the future.
Supplementary Information
ACKNOWLEDGEMENTS
This research was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture and Forestry (IPET) through Agriculture, Food and Rural Affairs Research Center Support Program (Vegetable Breeding Research Center) funded by the Ministry of Agriculture, Food and Rural Affairs (710011-03), Golden Seed Project (Center for Horticultural Seed Development, No 213007-05-3-SBB10), and a grant from the Next-Generation BioGreen 21 Program (Plant Molecular Breeding Center No. PJ013400). The authors thank Ji-wha Hur, Jeong-Ahn Yoo, and Su-jung Kim for their dedicated technical assistance.
Fig. 1Seed and cotyledon morphologies of onion and Welsh onion. (A) Onion seeds. (B) 14-day-old onion cotyledons. (C) Welsh onion seeds. (D) 14-dayold Welsh onion cotyledons.
Fig. 2Organizations of mitochondrial genome sequences flanking the atp9 genes in onion and Welsh onion. Arrow-shaped boxes indicate genes and 5′-to-3′ direction. Homologous regions connected with vertical lines are shown with same patterns or colors. The nucleotides on vertical arrows indicate genotypes of the SNP used in developing an HRM marker. Horizontal arrows indicate primer-binding sites.
Fig. 3Phylogenetic tree constructed using nucleotide sequences of atp9 and its 3′ flanking sequences of onions and Welsh onions. MS: male-sterile, MF: male-fertile.
Fig. 4Molecular markers for distinguishing onion and Welsh onion. (A) PCR products of the simple PCR marker. N: normal, T: CMS-T, S: CMS-S, MF: male-fertile, MS: male-sterile. (B) Normalized HRM curve and peak patterns of the HRM marker. Six samples from each onion and Welsh onion were used for validation of the HRM marker.
Fig. 5Distribution of onion-specific and Welsh onion-specific atp9 organizations among closely related Allium species. (A) Phylogenetic tree of 16 Allium species constructed using chloroplast genome sequences between rps16 and trnQ. Blue and red circles indicate onion-specific and Welsh onion-specific atp9 organizations, respectively. (B) PCR products of 16 Allium species amplified using the simple PCR marker. 1: onion (Normal), 2: onion (CMS-T), 3: A. praemixtum, 4: A. dictyoprasum, 5: A. vavilovii, 6: A. roylei, 7: onion (CMS-S), 8: A. galanthum, 9: A. altaicum, 10: A. ledebourianum, 11: A. fistulosum, 12: A. schoenoprasum, 13: A. splendens, 14: A. hymenorrhizum, 15: A. saxatile, 16: A. bidentatum, 17: A. amphibolum, 18: A. oreoprasum.
Table 1Primer sequences of molecular markers developed in this study.
Table 1
|
Primer name |
Primer sequence (5′ to 3′) |
Molecular marker |
Size of PCR products |
|
M1-F1 |
GGTCCCTAGGCGCGTAAATACCCCAGT |
Simple PCR marker |
730 bp (Onions) |
|
M1-F2 |
TAAAGCTGGCAAGAGGAGACCGATCCA |
|
325 bp (Male-sterile Welsh onion) |
|
M1-R1 |
GAGCAAAGCCCAAAATGGCATAACCA |
|
327 bp (Male-fertile Welsh onion) |
|
M2-F1 |
TTCCTTAGAGCTATGAATTGTGTGA |
HRM marker |
52 bp |
|
M2-R1 |
TTAACCACTTAACCGAGAACAGT |
|
|
References
- Albert B, Godelle B, Gouyon PH. 1998. Evolution of the plant mitochondrial genome: dynamics of duplication and deletion of sequences. J Mol Evol. 46: 155-158.
- Allen JO, Fauron CM, Mink P, Roark L, Oddiraju S, Lin GN, et al. 2007. Comparisons among two fertile and three male-sterile mitochondrial genomes of maize. Genetics. 177: 1173-1192.
- Arrieta-Montiel M, Lyznik A, Woloszynska M, Janska H, Tohme J, Mackenzie SA. 2001. Tracing evolutionary and developmental implications of mitochondrial stoichiometric shifting in the common bean. Genetics. 158: 851-864.
- Backert S, Neilsen BL, Börner T. 1997. The mystery of the rings: structure and replication of mitochondrial genomes from higher plants. Trends Plant Sci. 2: 477-483.
- Bellaoui M, Martin-Canadell A, Pelletier G, Budar F. 1998. Low-copy-number molecules are produced by recombination, actively maintained and can be amplified in the mitochondrial genome of Brassicaceae: relationship to reversion of the male sterile phenotype in some cybrids. Mol Gen Genet. 257: 177-185.
- Berninger E. 1965. Contribution à l’étude de la sterilité mêle de l’oignon (Allium cepa L.). Ann Amélior Plantes. 15: 183-199.
- Brewster JL. 2008. Onions and other vegetable Alliums. CAB international. Wallingford, UK:
- Budar F, Touzet P, De Paepe R. 2003. The nucleo-mitochondrial conflict in cytoplasmic male sterilities revised. Genetica. 117: 3-16.
- Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol. 17: 540-552.
- Cebeci E, Hanci F. 2016. Male sterility applications in Allium. Acta Hortic. 1145: 51-55.
- Colombo N, Galmarini CR. 2017. The use of genetic, manual and chemical methods to control pollination in vegetable hybrid seed production: a review. Plant Breeding. 136: 287-299.
- Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 19: 11-15.
- Friesen N, Klaas M. 1998. Origin of some minor vegetatively propagated Allium crops studied with RAPD and GISH. Genet Resour Crop Ev. 45: 511-523.
- Griffiths G, Trueman L, Crowther T, Thomas B, Smith B. 2002. Onions-A global benefit to health. Phytother Res. 16: 603-615.
- Gualberto JM, Newton KJ. 2017. Plant mitochondrial genomes: dynamics and mechanisms of mutation. Annu Rev Plant Biol. 68: 225-252.
- Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Window 95/98/NT. Nucl Acids Symp Ser. 41: 95-98.
- Hanson MR, Bentolila S. 2004. Interactions of mitochondrial and nuclear genes that affect male gametophyte development. Plant Cell. 16: S154-S169.
- Janska H, Sarria R, Woloszynska M, Arrieta-Montiel M, Mackenzie SA. 1998. Stoichiometric shifts in the common bean mitochondrial genome leading to male sterility and spontaneous reversion to fertility. Plant Cell. 10: 1163-1180.
- Jones HA, Clarke A. 1943. Inheritance of male sterility in the onion and the production of hybrid seed. Proc Amer Soc Hort Sci. 43: 189-194.
- Jones HA, Emsweller SL. 1936. A male-sterile onion. Proc Am Soc Hort Sci. 34: 582-585.
- Kim B, Kim K, Yang T, Kim S. 2016. Completion of the mitochondrial genome sequence of onion (Allium cepa L.) containing the CMS-S male-sterile cytoplasm and identification of an independent event of the ccmFN gene split. Curr Genet. 62: 873-885.
- Kim B, Yang T, Kim S. 2019. Identification of a gene responsible for cytoplasmic male-sterility in onions (Allium cepa L.) using comparative analysis of mitochondrial genome sequences of two recently diverged cytoplasms. Theor Appl Genet. 132: 313-322.
- Kim S, Lee E, Cho DY, Han T, Bang H, Patil BS, et al. 2009. Identification of a novel chimeric gene, orf725, and its use in development of a molecular marker for distinguishing three cytoplasm types in onion (Allium cepa L.). Theor Appl Genet. 118: 433-441.
- Kim S, Lim H, Park S, Cho K, Sung S, Oh D, et al. 2007. Identification of a novel mitochondrial genome type and development of molecular makers for cytoplasm classification in radish (Raphanus sativus L.). Theor Appl Genet. 115: 1137-1145.
- Kim S, Park J, Yang T. 2015. Comparative analysis of the complete chloroplast genome sequences of a normal male-fertile cytoplasm and two different cytoplasms conferring cytoplasmic male sterility in onion (Allium cepa L.). J Hortic Sci Biotechnol. 90: 459-468.
- Kim S. 2013. Identification of hypervariable chloroplast intergenic sequences in onion (Allium cepa L.) and their use to analyse the origins of male-sterile onion cytotypes. J Hortic Sci Biotechnol. 88: 187-194.
- Kim Y, Zhang D. 2018. Molecular control of male fertility for crop hybrid breeding. Trends Plant Sci. 23: 53-65.
- Kmiec B, Woloszynska M, Janska H. 2006. Heteroplasmy as a common state of mitochondrial genetic information in plants and animals. Curr Genet. 50: 149-159.
- Kofoet A, Kik C, Wietsma WA, de Vries JN. 1990. Inheritance of resistance to downy mildew (Peronospora destructor [Berk.] Casp.) from Allium roylei Stearn in the backcross Allium cepa L. X (A. roylei X A. cepa). Plant Breeding. 105: 144-149.
- Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 33: 1870-1874.
- Laser KD, Lersten NR. 1972. Anatomy and cytology of microsporogenesis in cytoplasmic male sterile angiosperms. Bot Rev. 38: 425-454.
- Moue T, Uehara T. 1985. Inheritance of cytoplasmic male sterility in Allium fistulosum L (Welsh onion). J Jpn Soc Hortic Sci. 53: 432-437.
- Oldenburg DJ, Bendich AJ. 2001. Mitochondrial DNA from the Liverwort Marchantia polymorpha: Circularly permuted linear molecules, head-to-tail concatemers, and a 5’ protein. J Mol Biol. 310: 549-562.
- Sakai T, Imamura J. 1993. Evidence for a mitochondrial sub-genome containing radish AtpA in a Brassica napus cybrid. Plant Sci. 90: 95-103.
- Schnable PS, Wise RP. 1998. The molecular basis of cytoplasmic male sterility and fertility restoration. Trends Plant Sci. 3: 175-180.
- Schweisguth B. 1973. Étude d’un nouveau type de stérilité male chez l’oignon, Allium cepa L. Ann Amélior Plantes. 23: 221-233.
- Skippington E, Barkman TJ, Rice DW, Palmer JD. 2015. Miniaturized mitogenome of the parasitic plant Viscum scurruloideum is extremely divergent and dynamic and has lost all nad genes. Proc Natl Acad Sci U S A. 112: E3515-E3524.
- Sloan DB. 2013. One ring to rule them all? Genome sequencing provides new insights into the ‘master circle’ model of plant mitochondrial DNA structure. New Phytol. 200: 978-985.
- Small I, Suffolk R, Leaver CJ. 1989. Evolution of plant mitochondrial genomes via substoichiometric intermediates. Cell. 58: 69-76.
- van der Meer QP, de Vries JN. 1990. An interspecific cross between Allium roylei Stearn and Allium cepa L., and its backcross to A. cepa. Euphytica. 47: 29-31.
- van Raamsdonk LWD, Ensink W, van Heusden AW, Vrielinkvan Ginkel M, Kik C. 2003. Biodiversity assessment based on cpDNA and crossability analysis in selected species of Allium subgenus Rhizirideum. Theor Appl Genet. 107: 1048-1058.
- Woloszynska M, Trojanowski D. 2009. Counting mtDNA molecules in Phaseolus vulgaaris: sublimons are constantly produced by recombination via short repeats and undergo rigorous selection during substoichiometric shifting. Plant Mol Biol. 70: 511-521.
- Yamashita K, Arita H, Tashiro Y. 1999. Cytoplasm of a wild species, Allium galanthum Kar. et Kir., is useful for developing the male sterile line of A. fistulosum L. J Jpn Soc Hort Sci. 68: 788-797.
- Yamashita K, Tsukazaki H, Kojima A, Ohara T, Wako T. 2010. Inheritance mode of male sterility in bunching onion (Allium fistulosum L.) accessions. Euphytica. 173: 357-367.