Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Phenotypic and Molecular Marker Based Screening of Coastal Rice Landraces under Salt Stress

Plant Breeding and Biotechnology 2020;8(3):238-251.
Published online: September 1, 2020

1Department of Agronomy, Patuakhali Science and Technology University, Patuakhali 8602, Bangladesh

2Department of Genetics and Plant Breeding, Patuakhali Science and Technology University, Patuakhali 8602, Bangladesh

*Corresponding author Gopal Saha, saha.18@gmail.com, Tel: +880-4427-56014, Fax: +880-4427-56009
• Received: April 14, 2020   • Revised: June 10, 2020   • Accepted: June 26, 2020

Copyright © 2020 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 7 Views
  • 0 Download
  • 1 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Diversity Analysis of Bangladeshi Coastal Rice Landraces (Oryza sativa) for Morpho-Physiological and Molecular Markers' Responses to Seedling Salinity Tolerance
    Hafsa Sultana, Uzzal Somaddar, Swadesh Chandra Samanta, Abul Kashem Chowdhury, Gopal Saha
    Plant Breeding and Biotechnology.2022; 10(2): 115.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Phenotypic and Molecular Marker Based Screening of Coastal Rice Landraces under Salt Stress
Plant Breed. Biotech.. 2020;8(3):238-251.   Published online September 1, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Phenotypic and Molecular Marker Based Screening of Coastal Rice Landraces under Salt Stress
Plant Breed. Biotech.. 2020;8(3):238-251.   Published online September 1, 2020
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
Phenotypic and Molecular Marker Based Screening of Coastal Rice Landraces under Salt Stress
Image Image Image Image Image Image
Fig. 1 Showing phenotypic differences between the salt tolerant and salt susceptible rice genotypes at the seedling stage.
Fig. 2 Clustering of 46 genotypes by UPGMA based on SES responses to salinity stress at seedling stage. T: Tolerant, HT: Highly Tolerant, MT: Moderately Tolerant, S: Susceptible, HS: Highly Susceptible, and ‘I-V’ indicate five (5) clusters.
Fig. 3 Showing phenotypic differences between the salt tolerant and salt susceptible rice genotypes at their active tillering [a (i) &b (iv)], ripening [a (ii)&b (v)] and grains in a panicle [a (iii)&b (vi)].
Fig. 4 Comparative salinity tolerance ranking of 26 rice genotypes at reproductive stage [T (1 < mean score ≥ 3) = Tolerant, MT (3 < mean score ≥ 5) = Moderately Tolerant, S (5 < mean score ≥ 7) = Susceptible, HS (mean score < 7) = Highly Susceptible].
Fig. 5 Banding profiles of rice genotypes using primer RM493.
Fig. 6 Banding profiles of rice genotypes using primer RM3412.
Phenotypic and Molecular Marker Based Screening of Coastal Rice Landraces under Salt Stress

List of 10 SSR markers used for polymorphism profiling.

Sl. Name Forward Reverse Prod. Size (bp) Annealing (℃)
1 RM1032 TGGCACTTCACGTAGCAAAC TGGTTCTGTTCTTGTGGCTG 149 50
2 RM11133 GTCCCGGGATTATTTACGTTGG TCATTATCAATCCCGTCCACTAGC 162 50
3 RM11669 AAACCGTTCCAGGGAGACTGACC TCGTCTGATCCATCCATCCATCC 168 50
4 RM315 GAGGTACTTCCTCCGTTTCAC AGTCAGCTCACTGTGCAGTG 133 55
5 RM12213 GGTCCTAGTGCACGGCTTGTCC ACCGGTTGTGCACACAAATTGC 98 50
6 RM8094 AAGTTTGTACACATCGTATACA CGCGACCAGTACTACTACTA 209 55
7 RM493 TAGCTCCAACAGGATCGACC GTACGTAAACGCGGAAGGTG 211 55
8 RM3412 AAAGCAGGTTTTCCTCCTCC CCCATGTGCAATGTGTCTTC 211 55
9 RM8095 TTCCGTGGACATGATGAATC AAGGTTTAGAACATACACACCGTT 111 55
10 RM7075 TATGGACTGGAGCAAACCTC GGCACAGCACCAATGTCTC 155 50

Different morphological parameters of rice genotypes along with their individual score and mean score values.

Genotype Plant height (cm) Effective tillers hill‒1 Panicle length (cm) Filled grain hill1 100-Grain wt. (g) Straw dry wt. hill‒1 (g) ms







nsl sl %R S nsl sl %R S nsl sl %R S nsl sl %R S nsl sl %R S nsl sl %R S
Holde Mota 124 100 19fgh 5 12 4 64j 7 22 18 17k 3 725 77 89gh 9 3 2 30ij 3 103 20 81a 9 6
Kedgrangal mota 145 104 28ab 9 14 2 88cd 9 25 12 55d 7 669 46 93def 9 3 1 51g 5 41 22 47h 5 7.33
Laxima 136 96 29a 9 14 2 88cd 9 26 13 49e 7 285 2 99ab 9 2 1 65e 7 71 24 67bc 7 8
Tulsimala 141 106 25bcd 7 11 5 53k 5 22 17 22i 3 314 313 0n 1 1 1 17l 1 69 21 70b 7 4
Motha mota 139 103 26abc 9 12 2 81f 9 25 11 56d 7 1133 46 96bcd 9 3 2 51g 5 52 20 61de 7 7.67
Lal Chikon 140 106 24cd 7 15 4 75g 7 22 21 5m 1 726 52 93def 9 2 1 33i 3 60 20 67bc 7 5.67
Calendar mota 121 98 19fgh 5 14 2 88cd 9 22 11 47e 7 162 13 92efg 9 2 1 47h 5 41 25 39j 3 6.33
Lal mota 130 104 20efg 5 16 4 74gh 7 25 18 29h 3 1049 38 96bcd 9 3 2 29j 3 59 29 52g 5 5.33
Biyonti monkhusi 115 94 19fgh 5 10 3 70i 7 23 12 48e 7 200 40 80jk 7 3 1 58f 5 32 15 52g 5 6
Kalo khaya 120 105 13jk 3 15 4 76g 7 24 13 47e 7 288 3 99ab 9 3 1 75c 7 62 19 69b 7 6.67
Khaioz 111 97 13jk 3 9 2 82ef 9 21 10 54d 7 161 23 86hi 9 3 1 56f 5 32 21 35k 3 6
Chorbindi 112 98 13jk 3 10 3 66j 7 21 6 71b 9 190 31 84i 9 3 1 77bc 7 20 19 5mn 1 6
Kajolshail 140 109 22def 7 11 5 56k 5 22 20 11l 1 110 109 1n 1 3 2 13mn 1 23 22 4mn 1 2.67
Dudhkalom 145 112 22def 7 8 6 29m 3 24 21 13l 3 973 569 42m 5 2 2 1 33 18 45hi 5 4
Kutiakon 143 111 22def 7 7 7 1 20 20 1n 1 1158 451 61l 7 1 1 12mn 1 22 21 2n 1 3
Kacha mota 131 104 20efg 5 13 2 85de 9 21 7 66c 9 1415 77 95cde 9 2 1 67de 7 63 27 57f 7 7.67
Sorbimaloti 140 115 18gh 5 14 1 95a 9 22 7 67c 9 832 0 100a 9 2 0 100a 9 70 27 62de 7 8
Chorboleshor 131 108 18gh 5 9 1 85de 9 20 12 37f 5 929 9 99ab 9 2 1 29j 3 27 22 20l 1 5.33
Bashful chikon 137 106 23cde 7 13 4 71hi 7 24 19 20ijk 3 1330 73 95cde 9 2 1 22k 3 57 27 53g 5 5.67
Bushihara 129 98 24cd 7 14 4 71hi 7 20 16 18jk 3 768 82 89gh 9 2 2 10no 1 68 41 40j 3 5
Kamola mota 132 109 17ghi 5 9 1 88cd 9 25 6 77a 9 102 2 98abc 9 3 1 78bc 7 35 16 53g 5 7.33
Joyni 139 106 24cd 7 16 5 66j 7 23 19 18jk 3 1156 46 96bcd 9 3 2 15lm 1 103 16 84a 9 6
Bamonkhir 122 107 13jk 3 13 1 92ab 9 21 6 72b 9 194 1 99ab 9 3 1 77bc 7 68 24 64cd 7 7.33
Bouhari 125 107 14ij 3 10 1 90bc 9 22 6 71b 9 274 1 100a 9 3 1 79b 7 40 19 53g 5 7
Birindi 135 114 16hij 5 12 4 64j 7 19 18 5m 1 582 59 90fg 9 2 2 10no 1 49 28 42ij 5 4.67
BRRIdhan 41 115 103 10kl 1 11 9 15n 1 20 19 3mn 1 560 94 83ij 9 2 2 22k 3 17 16 6m 1 2.67
BRRIdhan 49 99 71 28ab 9 10 4 65j 7 24 16 33g 5 2063 203 90fg 9 2 1 70d 7 41 15 63de 7 7.33
BINAdhan 10 107 99 8l 1 13 9 33l 3 26 21 21ij 3 1215 273 78k 7 2 2 14lm 1 57 23 60ef 7 3.67
Score range 8-10 = 1
11-15 = 3
16-20 = 5
21-25 = 7
26-29 = 9
0-20 = 1
21-40 = 3
41-60 = 5
61-80 = 7
81-100 = 9
1-15 = 1
16-30 = 3
31-45 = 5
46-60 = 7
61-77 = 9
0-20 = 1
21-40 = 3
41-60 = 5
61-80 = 7
81-100 = 9
0-20 = 1
21-40 = 3
41-60 = 5
61-80 = 7
81-100 = 9
2-20 = 1
21-40 = 3
41-55 = 5
56-70 = 7
71-84 = 9

Genotypic performance of 38 rice germplasm using SSR markers related to salinity tolerance.

Genotype Predicted salt tolerance response using SSR Genotype Predicted salt tolerance response using SSR


RM 493 RM3412 RM 493 RM3412
Holde mota T T Chorbindi T T
Dingamoni T T Kajolshail T T
Dholkochua S T Dudhkalom T S
Kedgrangal mota T T Chaulmagi S T
Sadamota T T Kutiakon T T
Laxima T T Birindi S S
Tulsimala T S Bamonkhir T T
Dishari T T Kacha mota T S
Motha mota S S Dudhmora T T
Lal chikon T T Sorbimaloti T T
Kalijira T T Sakhorkhora T T
Moulata S S Chorboleshor T S
Calendar mota T S Motha dhan T T
Lal mota T S Bashful chikon S S
Bashful T S Bushihara T S
Biyonti monkhusi T S Kamola mota T S
Chinigura S T Joyni S T
Kalo khaya T T BRRIdhan 49 (S) S S
Khaioz T T BINAdhan 10 (T) T T
Table 1 List of 10 SSR markers used for polymorphism profiling.
Table 2 Different morphological parameters of rice genotypes along with their individual score and mean score values.

Score range was done based on percent reduction/increment of different parameters and score value, i.e., 1, 3, 5, 7, 9 where 1 = Highly Tolerant, 3 = Moderately Tolerant, 5 = Tolerant, 7 = Susceptible, 9 = Highly Susceptible.

Mean score value was calculated by taking the average of all individual scores of different parameters. Means with different letters in a column are significantly different at the 0.01 level. nsl: non saline, sl: saline, s: score, %R: reduction percentage, ms: mean score

Table 3 Genotypic performance of 38 rice germplasm using SSR markers related to salinity tolerance.

T: tolerant, S: susceptible.