Abstract
Quantitative trait loci (QTLs) for the starch-related traits amylose content (AC) and resistant starch (RS) content have received much attention due to the potential benefits of grains high in these starch levels. In this study, QTLs associated with AC and RS content were identified using 92 recombinant inbred lines (RILs) developed from a cross between two closely related japonica cultivars ‘Dodamssal’ and ‘Hwayeong’. One QTL on chromosome 2 for RS content and 2 QTLs for AC on chromosomes 2 and 6 were detected. The F2 population derived from a cross between Hwayeong and two selected RILs were used to analyze the interaction between starch branching enzyme 3 (SBE3) and granule-bound starch synthase 1 (GBSS1). The combined effect of SBE3 and GBSS1 in the F2 population suggested that these two genes behaved in an additive manner in increasing AC. Haplotype analysis based on two SNPs in GBSS1 classified 117 rice accessions into three groups. At the first SNP site, all indica, Korean landrace, and weedy rice accessions had the Wxa allele at the 5ʹ splice site of intron 1, whereas japonica accessions had the mutated Wxb allele. This suggests that this splice-donor mutation is prevalent in japonica cultivars, but rare or absent in landrace and weedy rice cultivars. Landrace or weedy rice accessions harboring the Wxa allele could be employed in breeding programs to manipulate AC in cultivated japonica rice considering the difficulty and time to introduce desirable indica traits into japonica due to reproductive barriers.
-
Key words: Quantitative trait locus, Amylose content, Resistant starch, Rice
INTRODUCTION
Starch mainly consists of two major polysaccharides, amylose and amylopectin, and is considered the main component of many food crops in the human diet. Amylose is essentially a linear, relatively short polymer in which D-glucose units are linked by α-1,4 glycosidic bonds, while amylopectin is a longer, branched polymer that contains both α-1,4 and α-1,6 bonds (
Praveen et al. 2018). Variations in the ratio of amylose and amylopectin in starch mainly influence the physicochemical and metabolic properties of rice. Hence, amylose content is considered the most important determinant affecting the eating and cooking quality of rice (
Tian et al. 2009). Based on the variation in the amylose:amylopectin ratio in rice grains, different rice varieties are classified as
waxy (0-5%), very low AC (5-12%), low AC (12-20%), intermediate AC (20-25%), and high AC (25-33%) (
Biselli et al. 2014).
In plants, starch biosynthesis is a complex process that requires the concerted activities of various classes of enzymes including ADP-glucose pyrophosphorylase (AGPase), granule-bound starch synthase (GBSS), starch synthase (SS), starch branching enzyme (SBE), and starch debranching enzyme (DBE) (
Qu et al. 2018). ADP-glucose is the precursor for starch biosynthesis and is generated from glucose-1-phosphate by the action of AGPase (
Li et al. 2017). Granule-bound starch synthase is mainly involved in amylose synthesis; starch synthases catalyze chain elon-gation and a few branch points can be introduced by the action of branching enzymes. Amylopectin is synthesized by the coordinated actions of SS, SBE, and DBE (
Wang et al. 2014). In the rice genome, AC is controlled by one major locus located on chromosome 6 and many minor QTLs (
Zhang et al. 2019). The
Waxy (
Wx) gene encoding
granule-bound starch synthase 1 (
GBSS1) is mainly responsible for the synthesis of amylose in the endosperm and pollen sac (
Wang et al. 1995;
Zhang et al. 2019). In Asian cultivated rice,
Wxa (mainly found in indica varieties) and
Wxb (widely found in japonica varieties) are the two major
Wx alleles (
Dobo et al. 2010). A previous study reported that the differences among mature
Wx mRNAs in the five
Wx allele types (
Wxa,
Wxin,
Wxb,
Wx-mq, and
wx) were primarily due to an intron 1 G>T splice-site mutation in
Wx as well as exon 4 G>A, exon 5 T>C, and exon 6 G>T mutations causing conformational changes at the binding site of
GBSS1 (
Zhou et al. 2015). Consequently, the amount of GBSS1 and its joint activity are the major factors involved in amylose synthesis resulting in significant variations in AC. Starch branching enzymes, such as the one encoded by
starch branching enzyme 3 (
SBE3), also introduce α-1,6 links into starch and are critical for amylopectin formation (
Rahman et al. 2007). During starch biosynthesis,
SBE3 is responsible for structure in rice development and mainly participates in the formation of short chains within the amylopectin cluster (
Nishi et al. 2001;
Yang et al. 2016).
In the past, due to genetic relatedness among closely related cultivars, DNA polymorphisms had been detected at low frequency, thus creating a bottleneck for the genetic analysis of variations in agronomic traits (
Hori et al. 2015). With recent advances in genome sequencing technologies, the detection of genetic variants using sequence reads aligned to a reference genome has made such analyses possible and straightforward. Since the discovery of single nucleotide polymorphisms (SNPs), SNPs have played a significant role as DNA markers. Recently, Kompetitive Allele-Specific PCR (KASP), a detection method that is useful in revealing important allelic variations among cultivars by typing SNPs and insertions and deletions (InDels) at specific sites (
Yang et al. 2019), has been utilized for QTL mapping and identification of genes associated with target traits (
Cheon et al. 2018).
In the present study, QTLs on starch-related traits were identified using recombinant inbred lines (RILs) derived from two closely related japonica cultivars Dodamssal and Hwayeong by KASP analysis. The KASP markers were successfully used for QTL identification of starch-related traits between japonica cultivars. Since SBE3 and GBSS1 encode two important enzymes for starch biosynthesis, understanding the possible interaction between these two genes was carried out using F2 populations.
MATERIALS AND METHODS
Population development and field trials
A total of 92 RILs developed from a cross between two closely related
japonica cultivars Dodamssal and Hwayeong (a non-glutinous cultivar), with large differences in their AC and RS content, were evaluated for these two starch-related traits. Dodamssal was developed from a cross between Goamybyeo (developed from a Milyang95//Gimcheonaengmi/Ilpum cross) and Goami2 (an
N-nitroso-
N-methylurea-induced mutant) (
Cho et al. 2019). For QTL detection and mapping, the 92 RILs were grown in the experimental field at Chungnam National University, Daejeon, South Korea. Plants were grown during the same season in 2017 and 2018. To determine the likelihood of association between amylose synthesis and A/G SNPs creating premature start codons in the 5ʹ-untranslated region (UTR) of
GBSS1, 117 rice accessions from Kongju National University, South Korea were subjected to haplotype analysis (
Kim et al. 2016,
Supplementary Table S1). To assess the possible interaction between the
SBE3 and
GBSS1 genes, the F
2 population was developed from a cross between Hwayeong and two selected RILs (CR2121 and CR2138) with high AC and RS content. In 2018, the F
2 population [n = 156 (HY × CR2138); n = 54 (CR2121 × HY)] was grown in the Department of Southern Area Crop Science, National Institute of Crop Science, Rural Development Administration, Miryang, South Korea, while 210 F
3 lines were grown in the experimental field at Chungnam National University, Daejeon, South Korea in 2019.
Total genomic DNA was extracted from fresh leaves of the 92 RILs using the cetyltrimethylammonium bromide (CTAB)
method as described by Murray and Thompson (1980) with slight modifications. Leaves were randomly collected from ten individual plants per line and then pooled into a single sample per line. KASP markers, cleaved amplified polymorphic sequence (CAPS) marker, and simple-sequence repeat (SSR) markers were used to analyze genotypes (
Supplementary Table S2). The two parental lines were genotyped with 513 KASP markers at the Seed Industry Promotion Center, Foundation of Agri. Tech. Commercialization & Transfer, Korea. The KASP analysis was carried out based on the method described by
Yang et al. (2019). Seventy polymorphic KASP markers were used to screen the 92 RILs on 12 chromosomes (
Cheon et al. 2018). In addition, total genomic DNA from individual plants of the F2 population was extracted using the abovementioned protocol.
QTLs were detected and identified by the method of inclusive composite interval mapping (ICIM) by QTL IciMapping version 4.1 (
Li et al. 2008). ICIM analysis was performed using forward-backward stepwise regression model 6 with a 20-cM window size. The LOD threshold significance level (
P < 0.05) was determined (LOD = 2.8) by computing 1000 permutations. The QTL positions were assigned to the points of maximum LOD score in the target regions.
Thirty seedlings of each parental line were sent to Macrogen, Inc. (Beotkkot-ro, Geumcheon-gu, Seoul, South Korea) for whole genome resequencing. Shotgun DNA libraries were prepared from high molecular weight genomic DNA of the parental lines using the TruSeq Nano DNA Kit (San Diego, California 92122, USA). These libraries were used for cluster generation and were sequenced using the HiSeq X Ten.
Interaction between SBE3 and GBSS1 genes using cleaved amplified polymorphic sequences (CAPS) markers
To assess possible interactions between the
SBE3 and
GBSS1 genes, 210 F
2 plants were used. To detect the T/C polymorphism in exon 16 of the
SBE3 gene by using the
SpeI restriction enzyme, PCR analysis was carried out with the following reaction mixture: 5.0 mL of 10× buffer, 4.0 mL of 2.5 μM dNTP, 2.0 mL of each forward and primer reverse primer (10 pmol/μL each), 0.5 mL of Taq DNA polymerase (2.5 U/μL), 2.0 mL of genomic DNA (50 ng/μL), and 34.5 mL of water. Using C1000
TM Thermal Cycler (BioRad), amplification was achieved with the following PCR conditions: initial denaturation at 95℃ for 5 minutes; 35 cycles of denaturation at 95℃ for 30 seconds, annealing at 58℃ for 40 seconds, and extension at 72℃ for 90 seconds; and finally, extension at 72℃ for 10 minutes. Post-PCR restriction enzyme digestion was carried out based on the protocol described by
Yang et al. (2012).
To detect the G/T polymorphism at the 5ʹ splice site of intron 1 of GBSS1 by using the AccI restriction enzyme, the digestion mixture was as follows: 8.75 mL of PCR product, 1.0 mL of 10× restriction buffer, and 0.25 mL of AccI (10000 U/mL). The digestion mixture was incubated at 37℃ for 3 hours, electrophoresed on a 2% agarose gel, and visualized with a UV transilluminator.
Estimation of AC and RS content
Analysis of AC and RS content was performed over the two-year period. Thirty seeds were collected from each of five plants per line and pooled into a single sample per line, followed by dehulling and polishing using the KETT “Pearlest” Polisher (Tokyo, Japan). The polished rice grains were a mixture of both whole and broken grains. The broken grains were discarded and only the whole grains were selected for further grinding. One hundred whole polished grains were selected, ground into a fine powder, and used for the analyses. The AC and RS content were analyzed in duplicate using the Megazyme assay kit (Megazyme Ltd., Wicklow, Ireland), following the manufacturer’s instructions.
Statistical analysis
All data were statistically analyzed based on one-way ANOVA and Tukey’s test using MINITAB 16.2.4 software at a significance level of 0.05. Tukey’s test was used for multiple comparisons. Pearson’s correlation coefficients were used to establish correlations between AC and RS content.
RESULTS
Seed characterization and phenotypic variations in starch-related traits
The grain appearance, AC, and RS content were compared between the
japonica rice cultivars Dodamssal and Hwayeong. The grain appearance of the two parental lines was morphologically distinct with a large difference in AC and RS content. Dodamssal possessed a chalky endosperm with a white core in the center region of the seed, while Hwayeong had a translucent endosperm (
Fig. 1). The AC and RS content were consistently higher in Dodamssal than in Hwayeong in the two-year field experiment (
Fig. 2). The AC of Dodamssal was 39.25% (2017) and 36.23% (2018), while that of Hwayeong was 11.02% (2017) and 13.36% (2018). The RS content of Dodamssal was 9.48% (2017) and 9.17% (2018), while that of Hwayeong was 0.49% (2017) and 0.30% (2018).
Similarly, phenotyping for AC and RS content was carried out on 92 RILs in the two-year field experiment. The AC of the RILs varied from 11.51-40.59% and 12.05-37.42% in 2017 and 2018, respectively (
Fig. 3A). We found that the AC of the 92 RILs had a right-skewed distribution in both years (skewness = 1.73 (2017) and 0.52 (2018)). In 2017, high kurtosis (5.59) was observed indicating that the data were tailed heavily relative to the normal distribution. However, in 2018, low kurtosis (0.80) was observed. In contrast, the RS content of the RILs varied from 0.41-10.71% and 0.27-10.19% in 2017 and 2018, respectively (
Fig. 3B). The RS content showed a right-skewed distribution in the two years (skewness = 4.81 (2017) and 4.87 (2018)); high kurtosis was observed in both years (kurtosis = 23.30 (2017) and 23.79 (2018)). It is possible that the three RILs with high RS content affected the normal distribution of the data. High phenotypic variation was consistently observed for the two starch traits in the two-year field experiment signifying positive correlations (
Table 1). The highly significant correlations indicate that AC and RS content might be interrelated and could influence each other.
Based on one-way ANOVA, SMA led to the identification of one QTL associated with RS content on chromosome 2 and two QTLs associated with AC on chromosomes 2 and 6 (
Table 2;
Fig. 4). The QTL associated with RS content and AC on chromosome 2 was allelic to
SBE3. Moreover, the other QTL associated with AC on chromosome 6 was near the
Wx gene locus encoding
GBSS1. Based on the two-year field experiment, the Dodamssal allele at
qRS2 largely increased the RS content. Similarly, the Dodamssal alleles at
qAC2 and
qAC6 largely elevated the AC.
qAC2 had the higher LOD score of 8.40 in 2017 while
qAC6 had the higher LOD score of 16.39 in 2018, explaining 34.1% and 55.4% of the phenotypic variation, respectively.
Whole-genome sequencing of parental lines was carried out. Sequencing led to the identification of SNPs/InDels linked to starch-related candidate genes (
Table 3). A non-synonymous SNP associated with
SBE3 that resulted in a leucine (Hwayeong) to proline (Dodamssal) mutation was identified. This conservative amino acid change in Dodamssal is a missense mutation that corresponds to the T/C SNP located at exon 16 (
Yang et al. 2012;
Yang et al. 2016). Two SNPs, one located at the 5ʹ splice site of intron 1 and one generating a premature start codon in the 5ʹ-UTR, and an InDel located in the 5ʹ-UTR were identified on chromosome 6 associated with
GBSS1. The G/T SNP located at the 5ʹ splice site of intron 1 and the 5ʹ-UTR InDel are well-known amylose-linked mutations. However, the function of the A/G SNP creating a premature start codon in the 5ʹ-UTR of
GBSS1 remains unknown.
To determine the possible association of the A/G SNP with amylose content, haplotype analysis was carried out using 117 rice accessions (KRICE_CORE). These rice accessions were categorized into three haplotypes based on the two SNPs that were identified (one located in the 5ʹ splice site of intron 1 and the other generating a premature start codon in the 5ʹ-UTR,
Fig. 5).
Wxa harboring the G allele at the 5ʹ splice site of intron 1 predominantly occurred in
indica, while
Wxb harboring the T allele was mostly present in
japonica. All eight Tongil-type rice accessions belonged to HAP2-1 with the T allele at the 5ʹ splice site of intron 1, similar to HAP2-2. This result suggests that the T allele of
japonica was selected in the Tongil-type rice breeding program to reduce AC because Tongil-type rice was derived from an intersubspecific cross between
indica and
japonica. HAP1-2 and HAP3 both had G alleles at the 5ʹ splice site of intron 1. Mostly,
japonica rice has the T allele at this location. Nonetheless, the AC of the three haplotypes (HAP1-2, HAP2-1, and HAP3) was not significantly different. Among the haplotypes, HAP1-1 (composed of
indica rice accessions harboring the G allele at the 5ʹ splice site of intron 1 and the A allele creating the premature start codon in the 5ʹ-UTR) had an AC of 26.13%, which was not significantly different from that of HAP3 (25.61%, composed of
japonica rice accessions harboring the G allele at the 5ʹ splice site of intron 1 and the G allele creating the premature start codon in the 5ʹ-UTR). For HAP1-2, the existence of the G allele creating the premature start codon might be involved in increasing AC. The AC was significantly different between HAP1-1 and HAP1-2 (composed of
japonica rice accessions harboring the G allele at the 5ʹ splice site of intron 1 and the A allele generating the premature start codon in the 5ʹ-UTR). However, the AC of HAP3 (25.61%) and HAP1-2 (22.06%), which are both composed of
japonica rice accessions, was not significantly different. This initial finding suggests that the G allele creating the premature start codon has a minor effect on amylose synthesis. However, it is also possible that the sample size of HAP3 was too small and insufficient to elucidate an association between the 5ʹ-UTR A/G SNP and amylose synthesis.
Since high phenotypic variation in AC was observed in the RIL population and was affected by the activities of
SBE3 and
GBSS1, we further analyzed the possible interaction of these two genes in the F
2 population. To detect the G/T polymorphism at the 5ʹ splice site of intron 1 of
GBSS1 among the parental lines and F
2 plants, the CAPS marker CS06_001 was PCR amplified followed by digestion with
AccI. Amplified fragments containing the G allele are cleaved by
AccI, yielding 56 bp and 128 bp fragments, while amplified fragments containing the T allele are not cleaved, yielding the intact fragment size of 184 bp. The CAPS marker from the cultivar Hwayeong was not digested by
AccI, while that from Dodamssal and two selected RILs used as parents for F
2 population development (CR2121 and CR2138) was digested. Genotyping revealed that Dodamssal and its ancestor, Gimcheonaengmi, which is a weedy rice variety, carry the same G allele at the 5ʹ splice site of
GBSS1 intron 1, with an AC of 17.16% (
Supplementary Fig. S1A). This result provides evidence that the G allele was inherited by Dodamssal from its ancestor, Gimcheonaengmi. Hence, the ancestral allele from Gimcheonaengmi might be beneficial for crop improvement of cultivated varieties. Out of 210 F
2 plants, 66 had the G allele, 42 had the T allele, and 102 were heterozygous (G/T allele).
To detect the T/C polymorphism at exon 16 of
SBE3 among the parental lines and F
2 plants, the CAPS marker CS02_001 was PCR amplified followed by digestion with
SpeI. Amplified fragments containing the T allele are cleaved by
SpeI, yielding 246 bp and 371 bp fragments, while amplified fragments containing the C allele are not cleaved, yielding the intact 617 bp fragment. The CAPS marker from Dodamssal and the two selected RILs was not digested by
SpeI, but that from Hwayeong was cut (
Supplementary Fig. S1B). Out of 210 F
2 plants, 30 of them had the C allele, 64 had the T allele, and 116 were heterozygous (T/C allele). Thereafter, the F
2 population was subjected to interaction analysis using one-way ANOVA and regression analysis and was classified based on the T/C SNP at exon 16 of
SBE3 and the G/T SNP at the 5ʹ splice site of
GBSS1 intron 1. The classification was as follows: HHHH (Hwayeong homozygous (HH) at
qAC2 and
qAC6, respectively); HHHD (HH at
qAC2 and heterozygous (HD) at
qAC6); HHDD (HH at
qAC2 and Dodamssal homozygous (DD) at
qAC6); HDHH (HD at
qAC2 and HH at
qAC6); HDHD (HD at
qAC2 and
qAC6, respectively); HDDD (HD at
qAC2 and DD at
qAC6); DDHH (DD at
qAC2 and HH at
qAC6); DDHD (DD at
qAC2 and HD at
qAC6); and DDDD (DD at
qAC2 and
qAC6, respectively) (
Fig. 6). The AC between DDHH (20.91%) and HHDD (20.66%) was not significantly different. However, the grain appearance varied. Translucent endosperm was observed in HHHH and HHDD, which is similar to the seed characteristic of Hwayeong. In contrast, opaque and chalky endosperm was observed in DDHH and DDDD, which is similar to the seed cha-racteristic of Dodamssal and the two selected RILs (
Supplementary Fig. S2). The AC of HHDD and DDHH was comparatively elevated by the activity of the G allele at the 5ʹ splice site of
GBSS1 intron 1 and the C allele SNP at exon 16 of
SBE3, respectively. These initial findings were manifested in HHHH with low AC (14.51%) and DDDD with high AC (34.76%). The gene interaction between the two QTLs was significant (
P < 0.0001). The additive effect of the Dodamssal alleles at
qAC2 and
qAC6 was 6.51 and 6.08, respectively, while the dominance deviation at
qAC2 and
qAC6 was 0.23 and 0.25, respectively, indicating that the action of the genes at both loci is additive in regulating AC. The results suggest that
SBE3 and
GBSS1 act additively and functionally complemented each other. Hence, our initial findings suggest the existence of interaction between
SBE3 and
GBSS1 in the F
2 population.
DISCUSSION
Starch-related traits such as AC and RS content are characteristic of endosperm having complex genetic and environmental controlling mechanisms since the development and formation of seed endosperm is primarily controlled by triploid interactive alleles (
Ni et al. 2011). In our present study, an RIL mapping population was used to identify QTLs controlling AC and RS content. Dodamssal alleles contributed to the increased RS content and AC.
RS is a carbohydrate that is resistant to enzymatic hydrolysis; hence, it resists digestion in the small intestine and is fermented by microorganisms in the large intestine to produce short-chain fatty acids (
Englyst et al. 1982;
Yang et al. 2016). In the present study, the QTL associated with RS content was identified on chromosome 2, allelic to
SBE3, and was responsible for the high phenotypic variation in the RIL population in the two-year field experiment. A single nucleotide substitution occurred within the coding region of this allele (T in Hwayeong to C in Dodamssal). This missense mutation in codon 599 caused an amino acid substitution of leucine to proline in Dodamssal. This amino acid change probably affects the local conformation and three-dimensional structure of the SBE3 protein (
Yang et al. 2012). Since
SBE3 is involved in the formation of short carbohydrate chains within amylopectin, this missense mutation may lead to extra-long branched chains as a result of reduced branching frequency; thus, RS content will increase. Our result is supported by a previous study where a missense mutation in
SBE3 in the F
2 population derived from a cross between Jiangtangdao 1 and Milyang 23 explained 60.4% of the RS content variation (
Yang et al. 2016).
Amylose content affects the eating and cooking quality of rice grains. While the
Wx locus encoding
GBSS1 is the major locus controlling AC synthesis, previous studies have indicated that amylose is under the control of other loci; however, the majority of these loci have not yet been identified (
He et al. 1999;
Aluko et al. 2004;
Wambugu et al. 2018). Therefore, the discovery and identification of other candidate genes will be of great importance as they will likely offer new targets for AC modification. Two QTLs associated with AC were identified on chromosomes 2 and 6. The Dodamssal alleles at
qAC2 and
qAC6 predominantly contributed to the increased level of AC. However, the Dodamssal allele at
qAC2 was not as competitive as the Hwayeong allele that was clearly observed in the RIL and F
2 populations. Most likely, the Dodamssal allele at this locus behaved in such a way that locked alleles into favorable genotypes that allowed “allele selection,” thus affecting the heritability and distribution of genotypes in the population (
Neher and Shraiman 2009). The LOD scores of
qAC2 and
qAC6 were relatively high, providing more evidence to support the presence of a QTL.
qAC6, which appears to be allelic to
GBSS1, had a phenotypic variation of 55.4% in 2018, while
qAC2, which appears to be allelic to
SBE3, demonstrated 34.1% phenotypic variation in 2017. These results suggest that AC variation in the RIL population was not only controlled by the
Wx locus encoding
GBSS1, which is mainly involved in amylose synthesis, but also other candidate genes whose function in amylose synthesis is still unknown.
Whole genome sequencing of parental lines led to the identification of two SNPs in
GBSS1. Specifically, two SNPs on chromosome 6 at positions 1765761 and 1765799 were detected between the parental lines, one lying at the 5ʹ splice site of intron 1 and the other creating a premature start codon in the 5ʹ-UTR of
GBSS1, respectively. In the 5ʹ splice site of
GBSS1 intron 1, the
Wxa allele, which is predominantly seen in
indica rice, possessed the G SNP, while the
Wxb allele, which mostly occurs in
japonica rice, had the G to T mutation. The two
Wx alleles encode different levels of
GBSS1, which is involved in AC synthesis. It is noteworthy that HAP1-2 (composed of five tropical
japonica and 10 Korean weedy and landrace rice accessions) and HAP3 (composed of temperate
japonica weedy accessions) had the G allele in the 5ʹ splice site of intron 1 of
GBSS1. Recent studies have indicated that Korean weedy rice was formed from the hybridization of modern
indica/indica or
japonica/japonica and not from wild rice, and it possesses many valuable traits or haplotypes that may be helpful to improve cultivated rice (
Cho et al. 1995;
He et al. 2017). Altogether, these results provide support that the G allele may have been prevalent and maintained in temperate
japonica weedy rice. It has been difficult and time consuming to introduce desirable
indica traits into
japonica due to reproductive barriers (
Chung and Heu 1980). These obstacles could be overcome by em-ploying japonica weedy rice or landrace rice harboring the
Wxa allele (G allele) in breeding programs to manipulate the AC in cultivated
japonica rice (
Mo et al. 2014;
Park et al. 2019). In contrast, HAP2-2 (composed of temperate
japonica and tropical
japonica) possessed the T allele. A previous study indicated that the
Wxa allele in indica had differentiated from the
Wxb allele in
japonica by the G to T mutation. This mutation producing
Wxb may have increased rapidly in
japonica by artificial selection (
Hirano et al. 1998). Selection for the
Wx splice-site mutation, which played a key role in the evolution of the non-glutinous temperate
japonica group and glutinous rice varieties, is associated with a selective sweep. A previous study indicated that patterns consistent with a selective sweep in temperate
japonica associated with the intron 1 splice-donor site mutation were observed across a 500-kb genomic region centered on
Wx (
Olsen et al. 2006). It is notable that HAP2-1 had the T SNP in the 5ʹ splice site of
GBSS1 intron 1. Tongil-type rice in the HAP2-1 group derived from a cross between
indica and
japonica most likely inherited the T allele from
japonica and was developed based on consumer preference for a soft and sticky texture of
japonica cooked rice without sacrificing the high-yield potential of
indica (
Kim et al. 2014;
Mo et al. 2014). In contrast, haplotype analysis revealed that the G allele of the premature start codon in the 5ʹ-UTR of
GBSS1 might be involved in amylose synthesis, as manifested in comparable AC between HAP1-1 and HAP3. In addition, the AC between HAP1-1 and HAP1-2 differed significantly even if the G allele at the 5ʹ splice site of intron 1 and the A allele of the premature start codon were both present. This might be due to the effect of other starch synthesis-related genes and environments controlling AC. In contrast, the difference in AC values between HAP1-2 and HAP3 was insignificant, showing opposing effects of the A and G alleles on HAP1-2 and HAP3, respectively. This initial finding is not yet conclusive since the sample size of HAP3 was small. Further studies, including increasing the sample size, should be conducted to elucidate and verify the likelihood of association of the A/G SNP on amylose synthesis.
To determine possible interactions between
SBE3 and
GBSS1, genotyping using CAPS markers was carried out on 210 F
2 plants. The CAPS marker for
GBSS1 in cultivar Hwayeong was not digested by
AccI due to loss of the restriction enzyme site, while Dodamssal was cut, resulting in high AC. Dodamssal and its ancestor, Gimcheonaengmi, carry the same G allele in the 5ʹ splice site of
GBSS1 intron 1. This supports the finding that the splice-donor mutation is prevalent in
japonica cultivars, but rare or absent in
indica, landrace, or weedy rice cultivars (
Olsen et al. 2006). In contrast, the T allele in Hwayeong resulted in low AC. A previous study showed that
Wxb (T allele) at the splice donor site of the first intron reduces the efficiency of
GBSS1 mRNA processing and causes low levels of the mature
GBSS1 transcript and AC (
Hoai et al. 2014). The
SBE3 CAPS marker in Dodamssal was not digested by
SpeI because a point mutation resulted in the loss of the re-striction site, while that of Hwayeong was cut. Since
SBE3 plays a leading role in amylopectin formation, the C SNP in Dodamssal may have reduced SBE3 activity, leading to elevated AC. A previous study indicated that the proportion of amylopectin short chains (DP 6-12) of Dodamssal was significantly lower (20.31) than that of other cultivars (
Sim et al. 2015). In rice, it has been reported that apparent AC increases 29-35% when
SBE3 is deficient (
Mizuno et al. 1993;
Yang et al. 2012). The inactivation of
SBE3 in rice is traditionally associated with elevated apparent AC, increased gelatinization temperature, and a decreased proportion of short amylopectin branches (
Nishi et al. 2001; Burtado
et al. 2011). In the present study, the AC of the RILs and F
2 plants revealed that AC variation is not only determined by the action of
GBSS1 but also by the relative activity of
SBE3. In the F
2 population, the lowest AC of HHHH was associated with the T allele at exon 16 of
SBE3 and the T allele at the 5ʹ splice site of
GBSS1 intron 1. The AC value between HHDD and DDHH was not significantly different, but they had distinct grain appearances. These results suggest that the G allele at the 5ʹ splice site of intron 1 of
GBSS1 (HHDD) and the C allele at exon 16 of
SBE3 (DDHH) act in an additive manner, functionally complementing each other. However, the difference in grain appearance revealed that the G allele at the 5ʹ splice site did not affect the starch granule morphology of HHDD while the C SNP at exon 16 of
SBE3 affected the seed morphology of DDHH. The nucleotide substitution in
SBE3 causing the missense mutation probably altered the grain appearance, resulting in the opaque and chalky endosperm of DDHH. Previous studies indicated that the
amylose- extender (
ae) mutant lacking
SBE3 generates a white-core endosperm with a modified fine structure of amylopectin (
Nishi et al. 2001;
Zhang et al. 2018). Among the genotype groups, DDDD had the highest AC of 34.76%. The G allele at the 5ʹ splice site of intron 1 increased the efficiency of
GBSS1 mRNA processing while the C allele at exon 16 of
SBE3 probably freed more space for the synthesis of amylose by reducing the synthesis of amylopectin and/or the degree of branching (
Wang et al. 2018). The results demonstrated that the two QTLs have different mechanisms in regulating AC and their effects work together to influence AC variation. Thus, significant interaction was observed between the two QTLs. This could be possibly attributed to the effect of Hwayeong allele at
qAC2. This result may indicate the existence of gene interaction and may serve as a genetic basis for the fine-tuning and modification of AC.
CONCLUSION
The QTLs identified in the present study provide information on genes that are candidate targets for AC modification. In addition, the present study suggests that AC is determined not only by the activity of GBSS1 but also by the relative activity of the amylopectin synthesizing enzyme SBE3. Furthermore, our results provide preliminary evidence of interactions between SBE3 and GBSS1 for amylose synthesis. Further studies on the interactions between SBE3 and GBSS1 should be carried out to increase understanding on the mechanism(s) involved at both the molecular and biochemical level.
SUPPLEMENTARY MATERIALS
ACKNOWLEDGEMENTS
This work was carried out with the support of the Basic Science Research Program through the National Research Foundation (NRF) of Korea funded by the Ministry of Education (NRF-2017R1A2B2007554). Data for amylose content were in part from Korea genebank database (
https://genebank.rda.go.kr:2360).
Fig. 1Comparison of seed morphology between parental lines.
Fig. 2Comparison of starch-related traits of parental lines in milled rice grains in the two-year field experiment. Estimated (A) amylose content (AC) and (B) resistant starch (RS) content between Dodamssal and cultivar Hwayeong. Values are means ± standard deviation from two replications. *, **, and *** indicate significant differences of P < 0.05, P < 0.01, and P < 0.001 based on ANOVA, respectively.
Fig. 3Frequency distribution of (A) amylose content (AC) and (B) resistant starch (RS) content in the 92 RILs in the two-year field experiment. DD: Dodamssal; HY: Hwayeong.
Fig. 4Locations of QTLs on physical map. Numbers on the left side indicate the physical position (Mbp) along each chromosome while the name of each marker was on the right side. qAC: QTL for amylose content (AC), qRS: QTL for resistant starch (RS) content.
Fig. 5Haplotype analysis of SNPs associated with granule-bound starch synthase 1 (GBSS1) using the 117 rice accessions from the KRICE_CORE set and the estimated amylose content (AC). Haplotypes are grouped on the basis of G/T at the 5ʹ splice site of intron 1 and A/G SNP generating a premature start codon in the 5ʹ-UTR of GBSS1. Values are means ± standard deviation. Means that do not share a letter are significantly different at P = 0.05 based on Tukey’s test. IND: indica; IND (Tongil-type): indica (Tongil-type); TEJ: temperate japonica; TRJ: tropical japonica.
Fig. 6Interaction effect on amylose content of T/C SNP at exon 16 of SBE3 on chromosome 2 and G/T SNP at the 5ʹ splice site of intron 1 of GBSS1 on chromosome 6. Error bars indicate mean ± standard deviation. HH: Hwayeong homozygous; HD: Heterozygous; DD: Dodamssal homozygous. Additive effect: (DD-HH)/2; Dominance effect: HD ‒ (DD + HH)/2. Degree of dominance: dominance effect/additive effect, aR2: Coefficient of determination, bInteraction between qAC2 and qAC6, cTotal phenotypic variance was determined by regression analysis.
Table 1Correlation analysis between amylose content (AC) and resistant starch (RS) content in the 92 RILs in the two-year field experiment.
Table 1
|
Year |
Trait |
2017 |
|
2018 |
|
|
|
AC |
RS |
AC |
|
2017 |
RS |
0.695***
|
|
|
|
|
2018 |
AC |
0.789***
|
0.566***
|
|
|
|
RS |
0.700***
|
0.977***
|
|
0.588***
|
Table 2List of QTLs for starch-related traits in the two-year field experiment detected and identified by a single marker analysis combined with composite interval mapping.
Table 2
|
Trait |
Chr |
QTL |
Marker |
Year |
Physical position (bp) |
P-value |
R2 (%) |
Parent contributing higher value allele |
LOD |
|
RS |
2 |
qRS2
|
CS02_001 |
2017 |
19358818 |
0.000***
|
93.07 |
Dodamssal |
37.04 |
|
|
|
|
2018 |
|
0.000***
|
95.38 |
|
28.02 |
|
AC |
2 |
qAC2
|
CS02_001 |
2017 |
19358818 |
0.000***
|
46.55 |
|
8.40 |
|
|
|
|
2018 |
|
0.000***
|
31.56 |
|
3.79 |
|
6 |
qAC6
|
KJ06_005 |
2017 |
1038324 |
0.000***
|
28.96 |
|
5.49 |
|
|
|
|
2018 |
|
0.000***
|
64.95 |
|
16.39 |
Table 3List of candidate genes with the SNPs/InDel detected by whole-genome sequencing between parental lines.
Table 3
|
Trait |
Chr. |
Marker |
Candidate gene |
Locus ID |
SNP/InDel Position (bp) |
Ref (Nipponbare) |
Dodamssal |
Hwayeong |
Region |
|
RS |
2 |
CS02_001 |
Starch Branching enzyme 3 (SBE3)
|
LOC_Os02g32660 |
19358818 |
T |
C |
T |
Exon |
|
AC |
2 |
CS02_001 |
Starch Branching enzyme 3 (SBE3)
|
LOC_Os02g32660 |
19358818 |
T |
C |
T |
Exon |
|
6 |
KJ06_005 |
Granule-Bound Starch Synthase I (GBSS1)
|
LOC_Os06g04200 |
1765668 |
gtctctctctctctctctctctctctctctctctctct (ct = 18) |
gtctctctctctctctctctctctctctctctctct/gtctctctctctctctctctctctctctctctct (ct = 17/16) |
gtctctctctctctctctctctctctctctctctct (ct = 17) |
5ʹ UTR |
|
|
|
|
|
1765761 |
T |
G |
T |
Intron variant |
|
|
|
|
|
1765799 |
A |
G |
A |
5ʹ UTR |
References
- Aluko G, Martinez C, Tohme J, Castano C, Bergman C, Oard JH. 2004. QTL mapping of grain quality traits from the interspecific cross Oryza sativa x O. glaberrima. Theor. Appl. Genet.. 109: 630-639.
- Bao JS, Zheng XW, Xia YW, He P, Shu QY, Lu X, et al. 2000. QTL mapping for the paste viscosity characteristics in rice (Oryza sativa L.) Theor. Appl. Genet.. 100: 280-284.
- Bao JS, Sun M, Zhu LH, Corke H. 2004. Analysis of quantitative trait loci for some starch properties of rice (Oryza sativa L.): thermal properties, gel texture and swelling volume. J. Cereal Sci.. 39: 379-385.
- Biselli C, Cavalluzzo D, Perrini R, Gianinetti A, Bagnaresi P, Urso S, et al. 2014. Improvement of marker-based predictability of apparent amylose content in japonica rice through GBSS1 allele mining. Rice (N. Y.). 7: 1
- Butardo VM, Fitzgerald MA, Bird AR, Gidley MJ, Flanagan BM, Larroque O, et al. 2011. Impact of down‐regulation of starch branching enzyme IIb in rice by artificial microRNA‐ and hairpin RNA‐mediated RNA silencing. J. Exp. Bot.. 62: 4927-4941.
- Cheon KS, Baek JH, Cho YI, Jeong YM, Lee YY, Oh J, et al. 2018. Single Nucleotide Polymorphism (SNP) discovery and Kompetitive Allele-Specific PCR (KASP) marker development with Korean Japonica rice varieties. Plant Breed. Biotech.. 6: 391-403.
- Cho JH, Song YC, Lee JH, Lee JY, Son YB, Oh SH, et al. 2019. 'Dodamssal (Milyang261)', functional rice as a resistant starch with a high amylose content. Korean J. Breed. Sci.. 51: 515-522.
- Cho YC, Chung TY, Suh HS. 1995. Genetic characteristics of Korean weedy rice (Oryza sativa L.) by RFLP analysis. Euphytica. 86: 103-110.
- Chung GS, Heu MH. 1980. Status of japonica-indica hybridization in Korea. International Rice Research Institute (Ed.). Innovative approaches to rice breeding. Selected papers from the 1979 International Rice Research Conference. pp. 135-152.
- Dobo M, Ayres N, Walker G, Park WD. 2010. Polymorphism in the GBSS gene affects amylose content in US and European rice germplasm. J. Cereal Sci.. 52: 450-456.
- Englyst H, Wiggins HS, Cummings JH. 1982. Determination of the non-starch polysaccharides in plant foods by gas-liquid chromatography of constituent sugars as alditol acetates. Analyst. 107: 307-318.
- He P, Li SG, Qian Q, Ma YQ, Li JZ, Wang WM, et al. 1999. Genetic analysis of rice grain quality. Theor. Appl. Genet.. 98: 502-508.
- He Q, Kim KW, Park YJ. 2017. Population genomics identifies the origin and signatures of selection of Korean weedy rice. Plant Biotechnol. J.. 15: 357-366.
- Hirano HY, Eiguchi M, Sano Y. 1998. A single base change altered the regulation of the Waxy gene at the posttrans-criptional level during the domestication of rice. Mol. Biol. Evol.. 15: 978-987.
- Hoai TTT, Matsusaka H, Toyosawa Y, Suu TD, Satoh H, Kumamaru T. 2014. Influence of single-nucleotide polymorphisms in the gene encoding granule-bound starch synthase I on amylose content in Vietnamese rice cul-tivars. Breed. Sci.. 64: 142-148.
- Hori K, Nonoue Y, Ono N, Shibaya T, Ebana K, Matsubara K, et al. 2015. Genetic architecture of variation in heading date among Asian rice accessions. BMC Plant Biol.. 15: 115
- Kim B, Kim DG, Lee G, Seo J, Choi IY, Choi BS, et al. 2014. Defining the genome structure of 'Tongil' rice, an important cultivar in the Korean "Green Revolution". Rice (N. Y.). 7: 1-9.
- Kim TS, He Q, Kim KW, Yoon MY, Ra WH, Li FP, et al. 2016. Genome-wide resequencing of KRICE_CORE reveals their potential for future breeding, as well as functional and evolutionary studies in the post-genomic era. BMC Genomics. 17: 408
- Kwon SW, Cho YC, Lee JH, Suh JP, Kim JJ, Kim MK, et al. 2011. Identification of quantitative trait loci associated with rice eating quality traits using a population of recombinant inbred lines derived from a cross between two temperate japonica cultivars. Mol. Cells. 31: 437-445.
- Li H, Ribaut J, Li Z, Wang J. 2008. Inclusive composite interval mapping (ICIM) for digenic epistasis of quantitative traits in biparental populations. Theor. Appl. Genet.. 116: 243-260.
- Li S, Wei X, Ren Y, Qui J, Jiao G, Guo X, et al. 2017. OsBT1 encodes an ADP-glucose transporter involved in starch synthesis and compound granule formation in rice endosperm. Sci. Rep.. 7: 1-3.
- Mizuno K, Kawasaki T, Shimada H, Satoh H, Kobayashi E, Okumura S, et al. 1993. Alteration of the structural properties of starch components by the lack of an isoform of starch branching enzyme in rice seeds. J. Biol. Chem.. 268: 19084-19091.
- Mo YJ, Jeung JU, Shin WC, Kim KY, Ye C, Redoña ED, et al. 2014. Effects of allelic variations in starch-related genes on grain quality traits of Korean nonglutinous rice varieties under different temperature conditions. Breed. Sci.. 64: 164-175.
- Murray MG, Thompson WF. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res.. 8: 4321-4325.
- Neher RA, Shraiman BI. 2009. Competition between recombination and epistasis can cause a transition from allele to genotype selection. Proc. Natl. Acad. Sci. U.S.A.. 106: 6866-6871.
- Ni D, Zhang S, Chen S, Xu Y, Li L, Li H, et al. 2011. Improving cooking and eating quality of Xieyou57, an elite indica hybrid rice, by marker-assisted selection of the Wx locus. Euphytica. 179: 355-362.
- Nishi A, Nakamura Y, Tanaka N, Satoh H. 2001. Biochemical and genetic analysis of the effects of amylose-extender mutation in rice endosperm. Plant Physiol.. 127: 459-472.
- Olsen KM, Caicedo AL, Polato N, McClung A, McCouch S, Purugganan MD. 2006. Selection under domestication: evidence for a sweep in the rice Waxy genomic region. Genetics. 173: 975-983.
- Park SG, Park HS, Baek MK, Jeong JM, Cho YC, Lee GM, et al. 2019. Improving the glossiness of cooked rice, an important component of visual rice grain quality. Rice (N. Y.). 12: 87
- Praveen S, Singh A, Krishnan V. 2018. Molecular assembly of starch granules: Interplay of metabolizing enzymes in rice. J. Rice Res.. 10: 1-11.
- Qu J, Xu S, Zhang Z, Chen G, Zhong Y, Liu L, et al. 2018. Evolutionary, structural and expression analysis of core genes involved in starch synthesis. Sci. Rep.. 8: 1-6.
- Rahman S, Bird A, Regina A, Li Z, Philippe Ral J, McMaugh S, et al. 2007. Resistant starch in cereals: exploiting genetic engineering and genetic variation. J. Cereal Sci.. 46: 251-260.
- Sabouri A, Rabiei B, Toorchi M, Aharizad S, Moumeni A. 2012. Mapping quantitative trait loci (QTL) associated with cooking quality in rice (Oryza sativa L.). Aust. J. Crop Sci.. 6: 808-814.
- Sim EY, Chung SK, Cho JH, Woo KS, Park HY, Kim HJ, et al. 2015. Physicochemical properties of high-amylose rice varieties. Food Eng. Prog.. 19: 392-398.
- Sun YW, Jiao GA, Liu ZP, Zhang X, Li JY, Guo XP, et al. 2017. Generation of high-amylose rice through CRISPR/Cas9-mediated targeted mutagenesis of starch branching enzymes. Front. Plant Sci.. 8: 298
- Takeuchi Y, Nonoue Y, Ebitani T, Suzuki K, Aoki N, Sato H, et al. 2007. QTL detection for eating quality including glossiness, stickiness, taste and hardness of cooked rice. Breed. Sci.. 57: 231-242.
- Takeuchi Y, Hori K, Suzuki K, Nonoue Y, Takemoto-Kuno Y, Maeda H, et al. 2008. Major QTLs for eating quality of an elite Japanese rice cultivar, Koshihikari, on the short arm of chromosome 3. Breed. Sci.. 58: 437-445.
- Tian Z, Qian Q, Liu Q, Yan M, Liu X, Yan C, et al. 2009. Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities. Proc. Natl. Acad. Sci. U.S.A.. 106: 21760-21765.
- Wambugu P, Ndjiondjop MN, Furtado A, Henry R. 2018. Sequencing of bulks of segregants allows dissection of genetic control of amylose content in rice. Plant Biotechnol. J.. 16: 100-110.
- Wang Z, Li W, Qi J, Shi P, Yin Y. 2014. Starch accumulation, activities of key enzyme and gene expression in starch synthesis of wheat endosperm with different starch contents. J. Food Sci. Technol.. 51: 419-429.
- Wang ZY, Zheng FQ, Shen GZ, Gao JP, Snustad DP, Li MG, et al. 1995. The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene. Plant J.. 7: 613-622.
- Wang J, Hu P, Lin L, Chen Z, Liu Q, Wei C. 2018. Gradually decreasing starch branching enzyme expression is responsible for the formation of heterogeneous starch granules. Plant Physiol.. 176: 582-595.
- Yang G, Chen S, Chen L, Sun K, Huang C, Zhou D, et al. 2019. Development of a core SNP arrays based on the KASP method for molecular breeding of rice. Rice (N. Y.). 12: 21
- Yang R, Bai J, Fang J, Wang Y, Lee G, Piao Z. 2016. A single amino acid mutation of OsSBEIIb contributes to resistant starch accumulation in rice. Breed. Sci.. 66: 481-489.
- Yang R, Sun C, Bai J, Luo Z, Shi B, Zhang J, et al. 2012. A putative gene sbe3-rs for resistant starch mutated from SBE3 for starch branching enzyme in rice (Oryza sativa L.). PLoS One. 7: e43026
- Yun YT, Chung CT, Lee YJ, Na HJ, Lee JC, Lee SG, et al. 2016. QTL mapping of grain quality traits using introgression lines carrying Oryza rufipogon chromosome segments in Japonica rice. Rice (N. Y.). 9: 62
- Zhang C, Hu B, Zhu K, Zhang H, Leng Y, Tang S, et al. 2013. QTL mapping for rice RVA properties using high-through-put re-sequenced chromosome segment substitution lines. Rice Sci.. 20: 407-414.
- Zhang H, Zhou L, Xu H, Wang L, Liu H, Zhang C, et al. 2019. The qSAC3 locus from indica rice effectively increases amylose content under a variety of conditions. BMC Plant Biol.. 19: 275
- Zhang L, Zhao L, Lin L, Zhao L, Liu Q, Wei C. 2018. A novel mutation of OsPPDKB, encoding pyruvate orthophosphate dikinase, affects metabolism and structure of starch in the rice endosperm. Int. J. Mol. Sci.. 19: 2268
- Zhou LJ, Sheng WT, Wu J, Zhang CQ, Liu QQ, Deng QY. 2015. Differential expressions among five Waxy alleles and their effects on the eating and cooking qualities in specialty rice cultivars. J. Integr. Agric.. 14: 1153-1162.
