Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
Search
Advanced Search
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Page Path

Research Article

Loss of Arabidopsis PATATIN-RELATED PHOSPHOLIPASE 2A Affects the Expression of Genes Involved in Fertilization

Jun Soo Kwak1, Jong Tae Song2, Hak Soo Seo1,*
Plant Breeding and Biotechnology 2022;10(1):49-61.
Published online: March 28, 2022

1Department of Agriculture, Forestry and Bioresources, Research Institute for Agriculture and Life Sciences, and Plant Genomics and Breeding Institute, Seoul National University, Seoul 08826, KoreaJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnｯ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

2Department of Applied Biosciences, Kyungpook National University, Daegu 41566, KoreaJFIFddDuckydqhttp://ns.adobe.com/xap/1.0/ Adobed     ! 1AQa"q 2#w8B36v7XRr$9bCt%u&Ws'(xy4T5fH  !1AQaq"2B Rbr#u67Ѳ3sTt5v8Sc$4ĂCÔ%UӅFV ?_Aנj- H>>,m*>fzp"TrKkr^r.|_&]|*vPuܶvoQ1mwVJUhu-I"=LniAƕ8"۲ k*ҿ[yu:.vUQ+)%F DHyVBk>Hy8jݹ q~9D4KRmzQ)^ʔ.J%k_tVi5NTjg!'ky|5asOȻ)R۸ߩFMԿ3L4j6dڜ#NIwUF]JqB/(FafJRzq3\G՛ ?~\ 6)6W4m[O^L0E&rRMض*C .]Unl-1 1r#Rj/&QɈ׉˩s6Rj=5Tg.y.·Pӡ:JJS:C8-2u]d&vUz;7p9 5VnL֢"y)">iי(IDDd| Yj0; LRfS:ktYK%*N2^m|&dğth":ey)uPQZW)gcC3Pv&MMWd&Ŵ۲mvTRoժM03*F3Yd6\8,\hݻ kߔi<k NTwSԪmljj[>->ptU%'LR>&EBH$MQAUx[$Z6vi&_a.KIQ{hyƒ j"JOC9eFҝfj;˚Ω<[3_m% lQ@4g=5$(J]Yc-OMq<Ǎ wSzڗ)k$7VIP붾ͯnV+卵*t]iЎD31~SA1éC2u)ʼnQn-Uoi3:grI8ؓWm*G zܕ)ZקJ}Y YlGeJ6cB2I NS3Q>k=KTBT]W6+SOXQgGR? telˊ%-Re\hѯ2TF"C/OJΩ6r[N.0{SpljjX1“jOsӥ;ҭhe}xu`Ք&.)yO̒ Fߑ.$Qw;9Iw2o+RVJMSOj[SoҌZ%;`d$blQ{Ro{Imڌ>3egf\O֝Uzx"䢸g+mv%Gʆ:|V[N'&ס-ޝ'kfE|K,G&˳98Juin/\\Qݿ̋v~Ǩ!rtWU d|E߫R4d}.qPw*Ӭv5YEcn~f5c%MTMkb-F>5JT,})QHg%{("ӔȸWMsYyWNRrkkJr0XドnͫT}r-jj,Ŕʍ\Q2Ri>v$5!]"JB2WɅ)]VԜUc8i|.jeRO6^V.¸ Q&#|ܶ-*uOG%JAtRZRr]FFG\۩w+?'zչSѧt jz>KW&ot{7P&2D;&\\>Q2JzܗAKSfeNn[jRrԕf6,q,F1tRfԗ>vֶևj-&R'Zi2=xv~Elbsvm8=ӛ"ū񕜈BȩlWau[]ٷBߨF~J!|Ipr3R̴#Yp)={7:G{+:\W}n|Q#%)7^-h"Ƒq:M*%J&$T軨I333׎g_- ucBwwjp[6i25$̏bU’ٱRv?G\~#Iͪb7<<}Ezt" q_Inw,7-d,G÷%T* Wg1"䥱kq/A.,_KhqŒxwvo u2ۥۧ.bQ}XκA$֣ +K״ZUNmڸII{.v{5z5ѮRme[moyƾd~cRݾK'j.\i&/S6f|b=5: p!6i_ 4j6=.si˧eƾtS^c.Y^RJVS-Vi3,esi08?H$GvZgg?gi䤟2adw릿:"۪lkSN>q-4kI܋ێe̊qۅgDoѨ9; #T.Q;7#~_Ufstb_'w~Xw1Xk,vcOt._}v}8"(4Z\ۘgk?J?bm_c!g{HZV]Fkk%~gEt)b秴vΰB|꽸}mp~E6ݹv;7P٤v+ri*3Ԣ|'O14_~7nP{7ZU\Vű[ +7󖱅o#:ǥŬ\|3r%TJX]V7ez¨Y]lc|O3V! R zbJ'PnGqVJ"19WVeOF埜EaEJωqCN5Z g-9[S<$sUK5b|7sn\7x qmv##FF\ w[=-43$^ooVSiXօv7iB۴yg>]Vf"r$J3""32!Zh[K%7GvNLs+4nB/B{vlsobJaҺJR:0g%&zR\ S3T[&ִor*ⷳc3ʊO[iozW٨%$gn:ܶWwFBԹjHP&z u&F2\f;ipW73 [; '_̽b;vib!oec dC-tS__$Xs]l9&z$2/N>%'[}b{h/{`{Ji׉׏ YJB/X%}.|+{(S:qz]4_Kѵo`^tY_4S#* ^zvݾMr+TrkQ g.8Ͽ^i>ӈǙvix>$o( ^qt*&t1oJVu-ql5U6jCЉmĻ*"?JT=K'O/|=Vo}l0b}}f?X[?/\JSBe,kP8ETJ==?.p5ފgbU9}ǶdNKk—_$8̸͓ۍ8Di\BԿ-1v{FF]|.^ۅ{vl12׏z7-R7wE?\nh\jN/Kձr_oBw"N QMBZqe-m:ӨSn6j4%!hQ;sv'm4kcM=!8\m[M4{SMliۇ%eֽR&N:{2A8)THLK3Zj[jPBx#BگMf:G1\`edcʮ?|w(-̮vXt,bW2;.ιNHRR#YwTM"<;mk\.foIDjmlJ;vxy7o7i\,KQŊ9d^Mmgc L*.T6tLeIuOH3SJQ3=F/ʿ<9\JM6mN6=<{xkP!F1QR[I$6ُimXu2An2yԒMU q f[IB-'䤯jYm52&JG\zд\~vdg QtHGXw&1Lw+nDEdC1w|YJmvP)HZ>i0BPβә?R:QO["]I_Jʏۍ>QKyu^bycBq4lXF~l [\*N>-J6,Gq(Zr5h]CwYӤU~ʶߑ u*SIv%ZfJ7)! FS*s_\|IŸZ)J ]ܜi4"z[+Z,MOZ))}|Ʀ(RUNIII.S'ˍO~˨rn}M)xxӕ0 eyҵ7YMAB]ӣU:/ѭ*6bcwP͵ "+qēVjŹO|GtY4V j[mLV M -m>",B$ GD1~j6O4|LxnNmqATNR3ε|DŽa[fmn-ڭ+FiK7Pcm;r5 l8r{#-]'nrFh2ruycb;pW=njRqRJ(d mnpckNnʹ+6]tz~E=ʕ l ZZ5jSi3#47.Lcfe`9؏v囜.F\-UZ:*0_<Νu9Lӵm&)_3\^ҹ3"1n1v_|uRʞͫr'iȧN_kH׺8xXrj=\МH)V\ˬ.Xʸ oVRC}ySU9/OBY먌5 ٿwޞ)rw8Ӫi5*5ZΗcGƱ !ZۄlmpjJ -l <R̵/JAպZuq\IdUS 48wXJJtcg4cI~aqߓwŷrm-v)G7yS^7H^-\mŌAq|"m9IBnF㏉9[N+mmy/!KKۉ%n +BdddfFF6FQRN-U5;Sv'm4kcM=Mn)\qιqUd9F%",6MGdT%-+~ f%+y֛^3SrF>6lc(֪vۊN;g._0Sѧ]ETWرkQKzGe9ʨsKA"yC y2\[5 rԭ7Gk5Mzw_4sM3hxЊ'oÍ5jsub )ͪ~tR2H]R͍>̋m6=%(˿(Wrr-܅y5(ܔJ޺YunW̹븹NsqK ]/QR#"ZMDfD|43Qw|._ԡSqTZBg??O Ϥ)/E_U|i}2 9Z?¹0:x'3,whǣ?C y-A~=daJј&M?D1_PS+Oi&;a @;Dž7[ zZC"bv:jjMQk$M RԸ3uA\=wI.AwC"^.{?-\NSiˏ"b}T/}q/ o.1M}R%:-ZniʒL$SgrBW*,Mw'N\ɇ{s\j]VryG'8f`}'N<*/`U숻z CwHq18J+vԕKss4R53/&XTt1bZƟo\=%nO)h$rBi-nKĪ^ ջڜlwkYm[̑+/QrZo%TQ;TLs($2C:s.%+eoNttq۰kK7O0m_t_pZ1SsSM7"mevFZ[w -FJ*T*jФQRg BSu|]g:ɵzjqwmltL.e3sRMچkSmjkmWœިm++¦'tILk*բQ D,PB\lI[9{%Gb R6öۍmX-MaʉA931cs..G4CujQտ[9 }G-xwl)IQz j Ó"rqe&=]꾧֎c)<kӳ+0JrRR3'TnXi^xMF Bު*tIL.[h"2"nKzZe'ZV/RrNYz]8죝n]Ķܩ>^Ժ]u-7^\mZjܣ9+Rmn ߑv?oꋘ?&ƪy^N4o=3-ؔ̿*`}V݁ ƒPu8%$ ݗ]wt;\y\>='OjPIp/nJU8{϶FNMsf"ίNqƹ(+ ݮF2Km |jܴZs%zf*eȫ?]4)I۵nR&FX + [jDh(#哑9q9Eծj8noǕZf\J-l&Z˫}`ӎhyrΉn\űn]9pʌӣ"׮Wt?N4_I_~54#/my1Xr*척aS#DT >q ssΛW;3oUaJSRMDgQnt:Ql,/ ܷfRqiM Ȼ>Cob;A>ڦWقM9X~/!'MW.}Vrߔꔵ!5|iB(0-zF=}okڢE$^wW~nokY߮\6՜̌{i-AF*9)\t9IV6۸5ZUF6R$ŨQIq砳YUZ]eyv >hI櫥N )&l JulwE1GDOuFN2| }馥uC1rޫV+^gdb&W[4<^e4YW,d|htͮsUM)۸8:{3d{AѢ)~ \#J=NdƮꮓ90 |1K$v*?мS ]i$J,C,SG?/_՜pMSƯM|mG1V1$~K>CSvkuj=&) -,yLjuFHK{c駗.SOua;BrSqj-ۍZ#'Jys7[g2z/.u4+XV2VQ.ޕ)$"(%)#Z7suZ%j }BǬݕe)Jvz8zJf:hIN|svO1O#IEcۍjݽ:SdὮvu^@:o^5cs>i/VqmVm]ؔܢn6'vޑ̗J4Wn@OlKbX ;n:hgJ9ŻyǑz8f܌q&Y fN0N;[69 rbׅC2/#kE l&2~èMR.*%g=Ft.%؝e8<.e=Uv{~㻏"EˑnvDѭ͜Lu3u0:U֝$[M5<:oi+V4V9 6nXvx&_ q Qqw3W:uϔ2yb/(ɳ|5zQiJ#r|Hw#.W?4aDŲ\ugWG;Cw鐢K|xg)##=O.dF˟jMUvWĻsr.z]kPc9"]R)mkfOd*uYf١RsB Aîh=k]ʳUrrZsq`d#r$/Ը3o^&lRWȍyuW̦Y4QDUMJ65ƒ[+ygk XK_±k#y:8(TJOSQhJt2.DR}"5[) r)6V6u5k:eXZmv𭤔!푊Q[qQ}ҹLE- 8qIZG|UM4j}Mܕ[Vwm{} Naqµ"ԈM zOpKѰ?IAD3Ir0'/q1itoB5{%wkOBn-ۜduqIzYK60{+DʕܞqIt";r1mG/\/ym[6JƫR \L=S=OT@Ix[TMm{>ݾտ֒ݸӉLYIx>+"JVNzx||5rI?C{oz8۹e\R-^\A2F R+N9 vlT]"ۭ d)t֞i #E2jB@׵=#/N+!ĕhx}I!cM`ąZ*ŻɄҒ߮Y.Z}='/oۙ3IpW̮hT7cTSuz9>B}΄&h!>lӵn~j˅IvU.'v'CSZw8QK3G> ,J59ٷ+HSg䧎hJdzvwv-cvxS5[̊n~ؿ%ַX?O0\6ne 6kn9.ϯ} *h 8_QhLݣ7q +=XBҲ5?[[)+F`=4 }B,sNg==u*Nj9k_GJ)+R~GSPBȒZ:(K]heL=vKPӢwq(NrG^ثϣ?#tC?.ͼ[ۅo؞y#%ǛjVyLSw%T*s92JTM%"YkQО.q)gCͲn8cgi6j1MѾ[{9h^vƘǚםidfi.^RHmg&rׇz:}݃}xT$ضk'5s-狶,\vpbPD،=Okf.c#cdz2FK5T!&)|ntD<+OŹU i-G[EE*FDfeaf2QƤM\UG_{ǹm%\yrGy:.\4wjPGUJޕUV7Do\7Vy_13w;[?c]H\$IJ,*L]3b%L{y.JRKG2sq,B6T}(#nW|km+q5] r㪍bJ@y{byz,b踊3ϻJ,'^xd،)JVw#.Vټc''ÝպWtbRؒJz۠8!o9IۄS95E9ؔ-e9JR{dmnｯ<[~n${~Њ$W?&ՐY_? #a.ߑv?oꋘ?&ơ|y^N4o=3t=~7!/M3>n8W홎2M`Qx+ z qy8%]7_~540ۦ彷]Wq CѡwkďyF5Dum_}~P(5.(X,K9vᯐ?leB9;Jhm#3{CxGE-S{;@Fz˙]=O'!ɿ]' r`:7'2bЖ>Iy,/eTy/V<.H?UYY{\^#ѣr9^7?xoRȆ7EoS_&??zϾM?(~Q-K&>"~aߨ t7Emsϛ+?;fCr)fY+>z$tIkjn_>vnrֳki-˹l= t;'EyC¥|/BLwBJdgjۛ$s S1|ɍV%JI6KvəhzIlBYɒ|0"Sy0F>eo5W)O+X˻u';v)2vVq۳kۮws?UʑBǴYO漪e2MIjPAک\b1)DDؚKm6ZWΨgȕ۶yjڳ 2ضN[C[|r@9Jfo<_eI7q.|cÊV߷:i.:$ȋ)1%%)ADZCEBxJ0MJۥy(bNsKM9k43IwNt.\%N簤I'.j|ƃ2$grBEٌ\}9:v*!n7M(ɽ]7c@XxƱԨ37īf62cTTfFK]9wntQHͮvٱI/f|j=7}\_V5U^+:uljSȃY(XI.ȱmo1甅jڎIZ2>#\*:gY|4k\8ZwSqtyA!+];бޞKծË¥e)#5ap.QK^8VdU{*ѽL\=qmjnB5>{ Ӟ`v±5 ^k&O~Oshɷ,;6nOW>u6{RqS`)S%jp\ipdEBLfTWy$GIYw~䲭J.1vSY5z.V>^+Ǎvc.I[R{QsNR3ӎfhd>y?UJ*}~[e\i5U^͛E]G_FS(Iɿ]i8:4zj~շsW,ˆsy:%O}iur]iF5~3M:Ӟ#N06)4ߧgdawIotiz:1r5YDZLHBSi;NQc44la=Y kQIT*ըl:tq2(է9VO4뒳܂~2rq'nrVZŦ[t7\oլfb/mlpc.I8콚q^1iE~䰳mi[dۧw֤ICfdFeCsg:i| 6擣׋* 96lust^{%99UNRvaMܽo ammi$em4D6DD\nA%$$#}۷/ݕr99JMն[oT޲E"KTaP+HGkŴj5TM5xƱOS-k`ۛkٝWz;{kS}F;~q|~^_|euwnE'pSupUP)V]vE+t =ZRaVdG6= *.ϼnj9:UɷbېmF_tޫgHjVS'śǕًdkkѻ_]Kv?nT>)^e=Ar1'3ԔILyD?:-^in):{7.؂\.:V }#뺾.3r̸*xbFM aȵz 6SQ:ײj[ 8nn iFMw rR"5M5I旘35f^j='j:nNW.ʭocZvZKV^ɚJ.cM1ZI7E'6rg탸5oZ=[m Z`\hbMUR١Ȗĉ):Jin!_7Dй+f̷eKҷvͨBPR(V`y6tw*MRΝcB.ڭTnc;P$8nFvm4(D(R#R-L -2:FP lxZKQc6I("Km%$E, 78uXIFA$RQI$JbInG]c[ֹ:ZM+n^')JmJMJRu{e)7jQDw~%yQl}BZujSSf۩QZ+Dzhd5o%BIc'GZ?}΍:>Ɵivז-%݌J5MqGWTVʦh݇ܟ~Օ_6 n'{3~mϬj'J11OȻn߃r Qr\3y٘+WӍ'WxEs^O3 o~[|7>]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%-(\D4h{UK&ӡn^m]Fݢ:`δvj俜F+) y[{{ 7 tu>gvrěOj'5 iRg[ͶFjGe n~qT$ci ۚ0oԹc*jL[sVWqj\ݻ&6"WoK:cnWmrv)o>66(F>=W^bf#c zzʞtپy%mՉPël e}J.\Zk4ttt>oEM=q)hJjI=ͥ(%]脼_88ф;͛gWG;Cw~˘$4=uWdĜTثNDkiQL9U*O"4XP`02,Ge-k5$h>ܼ]3vr6!9RQPIVSnM(ۓ{>;/Qͱv{3&-[rc)ܚI$n{Sv3[j00)-D3z}MRzVQпj,T[uVs0\}Sid;r(ݝJ>æʺL&c[jPK0~d(FKÝW\m]GTcF|Iׁ)I3~#oX%vҦEݑؼ5Żv2qAZTE^..M{ʐfȏ2##.R}*KʛZz^ӞN*lPťLf\G6[WVQquV]XAi)5J!,$iJ6o$tPZc;Kjx_n3`qIelV~vLy{fn匋Ѿn%;zV.n'-ұdd2߽1bZksPe3TI9)$ԩIN9Vơ\=2885N\ p)/a柛w9g_lױo8ݷ iixJV& ғRi{N^_oAŮE6Y7I$Nk$|Q)-*4Z)^¸%4Qm [I%.c-OV+C֧R#%ѨCe3i;w$G+_dy| Fzj$DI(=OA gj%v/]8qԯNIS*֩',Q%\44ZZ%D|Ǧʴ6&vֵI$%8(ԬƾS&#Z. }6z?b/|Jl{ץv&mpx4Z$”ڝ4-H%dGKfM:sKSRWeJAn]>s6应-W9'H]'uȫYvgK^\czp|My\鏩w/ËQ.)]\QiS`8uL뚛̸=J"ܻi\å'-)54Ue]:K\퓡vK xwBqrH\*֕TnzC.mT=t-H]SČ~Nu╏NÅ3f|͡G~B+Xm[Q7U{9"~jgK Zoʰ7"qJ,ekSeNGgϳ] ^.6:s}_,%eRg<5⿨z{ZPun#jRІ.6g T.!]xa c#jN$Zpl̋H WZu8WmMRýsĮ?Mco~sx TU҆Q :KDG4n42.<3/'^?6/ܠڒ^yrrÿr2\D}}B]^E~^T cɛ7϶Y[<֞[7d}2%QPqOLEQR\CIsj1?\}%tJ0e~ *sk"*)&ۓEi#{1J8Hrt|'ܝRr8)=ƔN'RVz:cf]F7bZyZUȘ4x8,#JG̒?.W9XnO]KO]%]ƻ O5Γ/3qÓj؍/r̺rƵ 5\&m6h.xoeX[=<3%< lZ"2h\Z[&jW3ejm?k&[]ųj+{N{66leu_+lj]q* 7g*knأYv= q ەdxЬZ|%GUrQ3jLŒqET]1% qkXYūYc[7Ś]QY\jko\</Lc7+'hMSUc6qXyؙ~6#ѯv.0$BQi5YyIhɍiy=KD!n3Vm[V%W-B%swa97ajۗ m+9~]fKq|Ddaˑ0A]_v޺mM5* F-BYHJ5}q>ʉ.6hyDmpD׬'-_v5;5[8K[viJ.3dR:oYHHh9I7:۽fi+wm^ [)odPѱ52CZUJicSw\&_s0uBȍh32džzQflcd^m|7GѹE!fO5]]H9݇ZomT@]?5B:Z߂'`V_+/MSKX߆ޠk3?o7y:4R/7þ] iG߬aBRU&?r&/} cQߥGj2?C5Yśe7hU=?+ x龳f-܈czW^7p%5|Y:SJE\U-(a_cƣUǽXXKiȞNlmۊڭڄR!**ܤMeȽ$|X5(Ź\rJ~ܮ]>'HB0cp XFr_c?f?7<ukSgov¥iG>>䙗i.+t+bOjIܶ . i^:nm}s}(3>NZ$2Qg([".>i.ƾ)B̋M8+"- >eE6DݥJnJˣt׻ 5.˅nJGwZD~!i۶a,Db3ZQ3O#KO5/֍ozuK'GbRi᝘NV_ҝcvם ZoX}F6z 7e5_e:ۓj=AB+iܔERadMBq*ԯ DwI/Gy*mĥiRKg6skY/#SN4e$-yXM YL?^ĸNNӪ{$r1JJRSLO]Aqm>V/s[~i/j+m>z}eI"Qvp]{ZԼ:{vPAG2=T͡@ڐ#u"E*>C;o$~C#_d/HBq^YRٽzIKbOm\~żjFFGdiQ(*/i*#.FF]©m=BmpQQQSP&Ҫ!T&^>:y)$ˑÐFčI Bӡ-t!bM WҦŶ'UZ=}zvn~oT/\ǒ'nr8 AJIӆz<^uߖ4eFC1i+v!3qNyߕni?4JZlmYFXFۼO0B\m[ tʄU3s"Sr(NJ;SKW72L4̏BVdf^Ҹj\]ȱ۪(ӷm?J-KEmWڽ^4<8qu%9pŹW~877ܾeVгS(յe^C]yX͹! םm4FGȋ\y'Z FX7e)|Gjt߹#gb\ŧq_([R8[qU$Z (ʻezV2V!iQ,i$JE˂٩ a(GK'O{vnBvryRd-RK4=qxZJMl_CuuIz @Rt㮽޳!|68\-l[џ84-2Pu" RJ_^OL>G1~XnBŬw6J0*Uvlږ1N G1q9IUm*'oWu][&UyYZbBZRZNfEJf"+2nF~Eû7n1xv.RUM$6 lAxSQJ&n5ܞwlEói"#>4׿Q.nEq7Oko[1wg8ZQwZYiqtm&~">Bo?w͡ni2峋NCEy Ҕ+%ZJ ʩq*fpˤl,~^Mχk1+:ݕ z&Y`KLӪУDr3[*Z :(SL&ݻ۬Vqsyԭs x|iI߽zZrg.:mp%6ԜvgmpIUt;QbS.Է) ǨKSV,*lڌ|5Jt3#NP.=+OZ~/G سIgbꥹJnl_DUM\iM!֔wVZuԺ,yV.Q>f v:݇WiaŸN5Ҕ[M7SsrvǣrMW= \8ZW-jsnڕ.ZnF2qt ً[ٻޘY۷Zm"Jxr&NAfA-݌to9s359݆mZ+N1-qS$D=17 x׵+%_ ve4ir6Z$FDڗnFtOr'7'{9C˨ꤡaYoace{Refnft RR"4%ʌm:Sj3)OdInTO>X'vxV#jܮw9Fog;5.~Y5\~18YQܹvj4+~t7S ﬕs %^۵ڴDZV69R^Y+rj$ԇoJKR5wB9C>Y:l+EǎS{ʲ{T6Wi* ^^9k/y/Cs\g*qڵgn4T8mERr|Ti+iPe;;.i\EBEJ 丬i9ɧM-ԼsGDrZ>r#R>~X9y4b棇9JwV۔%m(b[Tjvl}۩~nDԺ{Zo-YuK1vx.nWuO+jN [ٮ0%"΢CdTJK-RަH"$I(*ve &҉FzB,_Vpqp9m8werv')E;o&QE׵^d9˦j\_,ڵugZȻ̧8k+jK{wmr@3ӭ2 wFkzFVqs1؛.v'I%$[iT]D5Dl2 nk7qUxԫLS+sا3/ΖeZYK<["%-g/kRs:f3;*E ت wJ%)5&+&rw*霣i|sMҴ|;R+fm䡩.!**dӶ-6s6,]zAXMWjmnz%SJߴm2UXw7MQ%<!tKys#P,W>s;3IYwx<+i_\\\U6 u7P|xbn_k&ӓVOe䦒 VUr,-㘘"-LZeOSҠթrEvq8Kf%5%&K"#%vD/.ZYYŏ+p$nZkvއuW9㓱Z G wYIFyf)?ƎUm5ԉ/'k84{KO:rQI}XRuԪ|*lu)3qZ[mSm5R3".Xcَ5c®ࢫI*۳~wRϿQWޝ(EJrri&ۥ^ʶ齲Im|[yb;mnm֩uiܘq>E+Ikx߄3r33-5𹻖09ϖ9[Tz~mr5NsWl$oPusޛ^{Z;);sڹf\3oٹZmԉ/'k84{NO:rQIBø8Bݱ3n֤DiK4u& ofSȒܩx<˘|N0Fչ]qsp"}! QWw@t4ӭ+cO5%]'*{eM߲DRO1y*q8w++e!c߶ܪlZWّM欼 CQ̼빶lX{vib/V/ ai;x6~]+z]MWB>re-:lgk}պ!#9?%܋V-c[z!W?c7YNm/jRr[HOzԻefճ0q15Zp#rkQQ0tU-AmڵP/cȕ?0cZYj;:0ZM=D6g ?'UN+ձ[K ܖB2'xq9{|۫N0ku 7xaj;n\ 2[VznMlWiKbSk))f..)Km)&bGZ=>OR܍W:j'rM'wYz&/鶧{Sʵb"vջq[I-ՌZH._x*BagC'T(Q:$ͳQcMCKy?3g'ߝqnT);qs #ؤZ}OOI:cfnc8W~qy.;^pVl]Hԓ>^H^@7-AA܃nmL(uWܻS߿ Td95Bdh4t6*dDh!EhI[iŨ\L.&Nc ܮf^;$R)\rip9I|ٺ?#R.ZDZ;/]nݻqs\QE9M&Bd ]N mN*D>tgbK>+ˏ.!23]BȔR1ɝ^j'k2ƮqBQq[$di]icV/e`޵B.FIIJqbi>Ӥ|p; 6${)RU>_e}^dzdfzi %ekRVUS?6'hׂ)5.\+qUgzE2C˷ecŏ^֔ibk shesFWJ#~> Wk~ݨ}ڶ>ơǚ)׽ZƉo~B-ڼrvoE:Ʃ3ۣK7+Y`WirS):{>ڛ}:wԨ(J_";6R%[u&ƫdZ_\'np| RJwNeTW,=rrbnkڄ[M3ܴz)3- R.?:okۼ0TU'w{6&w7j1z3ON'fGoO?)S_bQ_¿R(^ԴԴG.EtMڇ&RUiW uQjU> Kiu1d<ѥIQ'RQ1:O/lŗᏩiʂv&Jc{D5 Tt)1.n[n۶X}RjqnOʽ(~[Ns{ސ⛌uO,kgo֢dRNQȄ .'6W!׌P朼tdZjFGE"]K@'i۪N;sI[{SOzk>`rRR+!σj8&TjlvA̷Q?HyjyLHNտJMjܶT۽lG?SnKN%<‘ nq[N0Sq[Ta(&t(|HGO~gvkݻTR4&Z$#ViOY1r$6YF?e4U/Mvxų:zbU^gQQ+NW_'4jfz^c'#`rvrڡ(IJ/J ݦ6 ]-CW |_{v*_q3^DZ}Ic6Uڌ8p7{crZq5ki`)mU6|-Z5^iEz3P=:Cu7DF'k%}<C-޹ֲ̱#\,(f88%X-N(ck0VLR~} G"-8ӏ/ϰKq?(#nrVTmZ;zióM4 m |UT'C^_1X.gXM{%ʤd 4\ovN":"y-,T)fLQgۢr=/CƹǨJVr[a+!rT|%Y\ٱzsS>jͱ.oOc6f$q% ǒGo;n[];ߎjrk{~\VۓNIGn:iqxo |~t5)Rxעri{Vi&NUOl_ѮMfsޕkЄay.0P{7N((BaIP$ K"U6Gl ݙqJRu+qN$ m#*p<|{:>-Ev=86N*MM긭U*uѾ?/^o7;'u,h4݌xښRM:5.(/ \իU.{F^rmF-Jɷ.>Q"[4xT^OZ~mK}T0ݛ^SAo9u?lX(' qj%=X}"^e4wˠ|rܫ 6I\Ķ;Ӻw!'ڍWg{ i U_9Avhۣƾ+:vs/MK[ɭīe{`Zgb}r[i'GE2J7Nez579wRq+Un ]J.cJ4M:h箽Wxxm^ pc\wcN%'My $$| :$Fqɏ¾^қP9J6Wxvu}ݵP>Z'FFdg"-; [¢cmWkÎT8nG%ݣ7*\խCLRYZͤiD&J#'ehbSyXK|y*ӞpS̍R`[pTr/Eg)K+92{_ n3zwz'oŸۤ+sOj J:`T>Cf*lwd\fYOP"R E֢̔L4ɥ :;.b(B02rJ蠟9>V'9M%)IqnhP<%,r'P/vNSwr#w"ݨaqc(|{kd=^0jTMR2ULNz|.<|^PfY22##!,K~E BEJۜ&jRNsHަޛg\r,v؜.jK3)[EJ2ii{KEiHP^&]Gn8x=K}Wx/KI9-ϵwQ%spܾ[^R}S3$qvq8M[ ozKxcqmJ/ӿ{_}7&ݨ\f6ZSyQz& 7ۉ[8~UNn|nkiTB+4RI8'Nc%tn{!]Ȋo.nEmʱn𵵥J A+wy#+ikǒڂ;՛s85'KmE:Ђu""Iģ5p=БbTY-ͽڔ詻ngL2Q}$de# fs^o{DUUsfwӶ;s1T,ǤtޒQ\෼J=.tKU,7čJ5 N$y3kdSMQU~mO[03 $zAڟsF5^뜞"Կ QHmrR"ӳηer+ҔZ]hE-6Jmt'ޒ=O[sQj)6K}?e4v_KfZheޓ=BV[bY}lݒTTЬ{ȫvO_qpRApVŗ 6ju=*BR)g "O1yhb=tqJ gtm\b3RY+JQ^Ō֍\յ\>+uSi{=x ^w;uӘ#ĸzLn*$anok߷CBӷ}5Yqvdž<( "_OWit5:EZj2 B ρ1̊fi[n!HQF82q1牙nqnEpT(2RMoM4ϳOu ':֧_Xjsg jP^(ڙ{2%E͖j^}ZU[Q$'U) <܂%!s"m R'G5M0<+zM6qYm$ڕ$3ǧH]?o2N<8F1̻r_my[Rf59NjpzBnl7*{.QP 3N&^BLJPjAHCK2Q}$#~YMq8 k(MFMU)8MEqTy+Tʞ-ar5yܕOXw!e;q-Jqܶ䓊Y:LC UE{/t>r"lI9)3KJjϤA 6SEE$d߇3KG*En|P\ԭTn6I-ƍKTj<1H_zwGr19wF N8ݝ+a9ɫM6mhePi%mmD! """"""*1bRKrD"vnrM۫mmĽm]ӡiG~e"˩ lhRTMk^MX["Jݱk7_ޕ*DqĒ&flՒ}`W}~SմZ{ĕ~wm*/{{ѹ_-0ط#P]xlڱ~Tn5wi*lڪ (JxioϏbqKYR|!|KN53 OS222$jzww%i}>N)E+rۥ7c$Ofl/LNث\6H9: FY󡈾I)fB֔JI_ ֣^: 9mY{66㒢7Uj]:.-os[R&gMF3˸#໹kmjq^8W"PΦURjʄWa˧T!͋ lW48JB2ko+ /Nw QwQzQ ے%$ޓ7^YL|r7!v%Trܥ &|M8~ybrn[RV gSn{{*#2#ԽᢏӴHak" ӌcwҜw&RJ07ױ>Ļ =^ BɆ)v32.M1=#6%̠tҤnzqMwԣ~s*%-j|_m*.Yx9Sz=)qE4 3pk+,`=kNRڥ=B=nŔNAx)Q$ԩȧ4z3t#Z2lҮYn$S%y- JzGpu|LBV7ZW#;Wwipܷ%(6jFG5#{$D"uۭ~]֫SrD܃fҎӾ+Tu>-ZTQ& N|$沸ii>eRWݳu'[O̻j8JۻEѩ[]vni= ڒ,[_%kC7I3Nv$4ɎЈeٸoUu:[}Do5|zNq=Tre%ɧ6&~DȍF]ƞG5q m]/w/ \ʲr8=oʔe9U(W"|S]uZd#?Se[W"ֿh][-7Nu:T=)R}.;ml*5Dlf $fF(̏T hiIUU4Szɕ t(%_|2 ~6eM;TƗK[f&]LK^CE2[ȏBOd;Mi|cx,^6;sیGpQ\NuJIFTJ~đArh* B"$H쉩eXPRj?sl"ԥ)su]xpԴY%VESH"ЋJǰ K&5^Ukzׄ8kEgS2h&Se\ Yl]WҶp-ZUvi7QS:4byqOo+[̺腋[6-_Fo.6[7$p&^ _GZԸߍkc.qqoI[9m߸YxOZЦ1uoiSH)P9Uʄjcq= S>֙NeR><;+ڌk%_qT].srNO?s[=vH[]RZHRMtᩗVؾ:/~u)ԍdg%=edVrISb{6vSu=(ܥ)mTv/J}̇8 S3ad:^hBSf؉OɔLhI_1d8,L><_A0y3rXq"'(۱;mFNII.v5_(^q~X>y{3צ I*Vܛv/jW' T'NR'j%ꔩ:mJ3SB}΋!-H-RJBТQoedi9tjENenPpke.%4]#{:>mkEɱdYWl\\\'nRM4&U>?Ќˉk÷!𴪛]]5}UqG~ݏI"O~s6(Ļ)qO~h}uԕd}Q~G,oE!&G&/]_H-O=o{k\̭bkv.Ô܈+;arZx)m?M\3lU$mk-CFXjTv6u' g:Vn_*qk:VC A%'4JV%EY)#BғO4<e׿jQQ]yUr4=wm[K1r׵%Iũ-O}|kC;/VcݩWZ)EHdžTru]8hgĵ-;=>U_ InvTm_jBM+QiF"9*{DI/iuo(=TzϖmPQl_v4z>T*ȴ>YF;ε\t]EH4ꌇ[VrLzef 2T^V>g2~kg5~Nק;{~Z~W}&ŒBӿS2$J?~(Yœ"˲ߩ\O]: J׉ښT{mmIѩn3˧)4LdFZ/zUG>U> n 5& ϴ-KJi2o]uKljvK3$bԔҚV旧iY5.ίfi96v7!v))FJM4{jG~Jt/lUE%pTAFe4qQk\ve۽/u/Im+W')v{\-E|Pms7߮DZRr۞/mu*1ՙaB܆ -xg3#6ۥtRogʌU)׎]ZҞNnŞr}F1Nnޞ;cZ{N}ۿMiuxʉ*3qi'9KHQ$WJxXyرŔe~[v5~/jN9Q4o6rJv FrdxM*iRjMzUinHdн7ᾞS=S'7 } ̽zt7K|_g J=Lq+/Bw_\ۧx\HJUPzQ<hqF[V0x==CsU7q|^ {)Iq38$_A(VgcKu06Ƅ"%i~_ˉk QCܣB8Ku/񋇵u([w}$F|8TՠI.E !;RJ^}MɒD_q2];Ɖ{5}*n7nEInO{Mwv}&q+v [V}Ĝ@%>#dXQ$f;iep.GquixVt x6bj͵mlKقQ[T]zs/&yەnM'W}!Fp_d^Tu N{ɻ'l{խ2.sTu{W^H&;1s)Pӛ6>$mě;Łnj= fLT)>׸+qReɴ[UR\L*P/!$Ӊ3Q 'K=m~6XqW3^W+ųO_[F$rR*u"T%@O +%# ]˽!aܽz{ͷvQh쩎]hGތ5ɇ*DzJDRNLi 4:{~2FmXY-zzĽ^f=]uū{/+&c:Ma{ĝDp2m܍kHș/(--m_vݮK(V{R}.k&yƴ7i^4@3f sK3^Ř˸B=]?gt5KbZB<e;kQLpxuWC}n 5ҴepB##~q= `x]KWF {GfŲ}?G.I9pjWkU]>={7q{kO/^I3==f1ɏ%nnʫ/Zu_yXN<57ۍ'vy/"8넭M2eԷ&Y,в33%IkjMr7xf nmQkX4踼>a-GcIeތw&U=-:qnW)z¥j :WqSZvԒ#j"KrIU)%qrmRoDGQ~SYRsu*V)  ,/x)MFD6O#]z 96[Ui(JRfw'y$GeUީkdMF-ݻ98F2d[o{Rn0n-xsV6Dh|Eb2E:KCOӪv4SJCr"J!!m,hRLD| ZYFm/X~ΧfrN&4Ƒ=Z9Mh.Mܵw/BdrܥniŪ8ɧ|y%œ[M=_tj?F!z5\evM:\ ~F-sg钬OWq“iiȍ<Gi%%n2rqͻllƑ)okw7}\Uk-:&fj솘XerV9yZuʼşdFC=rmo%~ZN78X(N)_7.Εn1MpJ}62jjJdI";R5&iLԸc:jmqiQj$ujp\{;v5B񥍪Xn Ą4qOERjzN(Ga٠䌡)p*v(J7#ZۻZ8O W uONb+^Qipv9GvֽƼϯrYƖKGJQDNPhRJjᡧC"21"9ѓS1;R_O7/WGz)8fE%F2ukmvSov/iZ&/]~KmI[:^~ͤ\kMi稜\ywJt3W7 8Ʒ~ݥeFgѼw"8VVSج\뻆}ݭ/J6Q)d|)zU3>k\L=;ow֯gN3pKѫ|wmkZ$z^2R:E)f>ς нd|#׆?\ǔpV{;\$ƵE%-ͪm0S6[n< kE[}mvE4DDZ^$OZ0*$~XUv҅B@^?]so#%ojw;Y#SxxueBگy v^i-)s)zV jC{7Gt.w3v,ygg8s]aE_,*E tY5k٨h=o"m泏:\6w噓aiL׎n^c\75AGkЯ0Lf46َ`egZ˓p/k;̛]kq!ݸzpԭG"}R9Ve>ˏHUjJ-&7nrnwG*Xv\˱/vN}O)ʼn&CV͍f̵]r\PMB-6Du-#RͰtRN^)mT _}nSȕC*_xBuTkJW[`ɩ`ejvsngP ڻ.-WUtܑqԹQj)t;vN&RNũT+8%IXӃ5fK՛-d9 ]CƑm|nZ-6=Hz,*aEm W3VzRšdY~Xf׀Xx"]s;)5u*ُHB BRGS6bݶؿ 9j[1*jױga7oX CUI%0v#~\-O-Ꙛuɷ쏪&5mY٦M`LJ2qK~HZbr =N'YobI. (^ ׾{_ ?OJ`S`3BN[}5w6:ǵ/iSlt=4F*d&T4y/#. ɵim5Uֲf 眕6Y7 fơ=3dϕq뚩$qTM-%r!$@A? ޾V0c~{[{;򥧅a~ڵ»&ڄv1ek=wb MLkNAԬw-x>~/r=e73VeVN)K%Sښe"+3uXuچrn ֺVzscJ峻m}vb㶓n\YbIUBT%*,0nov=;z꣓S/nSXSpl##k9mXGrZv^Gde!ŷRԠzQyjC]`gToPov{j~KRBMY}i[߶9KL2ԉO0K#m>wB[ٍ+n[[b٦DX ݲpo] [\m5qdT()mo4Oy9Ie b][wղmM~vmi۱~t \}$яimRk(L c Cvk7r9_r1 ;zv|F@KyZ[&jEji/"6$69ml#e]9s\{ScL}Ȣؿ0q/nZ*t,CLoD߉Njǚy=Pgmu6^]l-["çUʖMlʍp-"qmU>۷uFOJ%Ǔkx 'g=睋k[3u,{³WɘݪF]ՍeFX"Oy\,cچ=w/gn Ļ]#2? vqy-gXnR.^}ݺFs{ŝG]}e|#0mjx"ƬWكm?rgU^xVB":Dt>@LRbun~ݭ,w+v⪕;\U(RYa61>#Jm˞Μ9g9XKaG='u8gf}'qy#ɉw J]We.ʲ-<+&q%s?2dњztҼn`cΤmmqMdz O[-ߩӲ&;[tmܝVnr">{x<8U+p:Ig]zjGkt,uzf}dؠoJaکqEq -(:d<պ=eKy[˗^%ZXkX[C2߱\ITTLGzANM￵i]K>UsOGDDD.ZF6* ҃V Zhz{'xp^`wo8r0h ZmJ5"jb[l=yUu7-;7IT%:jFjߖm0tzU'K)څNۧYJ)4IQ}^KWm7kSP>q;ނ#)'n7&׊r?óM{IwR\j2Qn[v pe#/tAF\ϵ225q֒om6z})6҅*oqDsMf CNIN=T S2t,_ѧ}kveMF0J\Rnnݙܹy[rUc-j{yGtkQ%s]5qB.Nw.JN1LvR Ui5J ZESQԙr):MJ+g}χ!2;q([jAud][ljVK3$ײSJI=/|&tl'*n۽f.frܥ jQO8>&Z];.|7T/C}$ڋUmP2Reҭ8hFF\L 3~e v\۫]ݝNmrnB%*]Z«hKc=BTLG :V74$=Ǘy+EX'4tn(I:Ѝ;Df8c,k1%dJ6.j6ź{N~l6&*fœI7 WAlGOu-ҢH,,(ǔe뿋쩨kM܍ZſgRvQ' 9)?n|er˭|I|-fGK.rΛp8XV1%K6mvG+tc+qE&ǸC_Nm:l=_/m5^[dߌڇ.c<%:)tQ$Ow~-aY;UJ>=F)2[nk؆?훐M=l6[4(O.]2#-H^n#->&mp5~Fӛ+|| S,xag%qkEUzUgæBhߕP(7]kFnq?֖CpruZ6*rEڊtS|*tI*E}7R<,nUU֫^I7Q*mSly%rdȓd8hE<9oHhMfNSRj[i7D[Rj݊+kდq{"$$H?p\̅S?㭻;t~R߁)^/>Qj`yt[w ԛ;²~+ߔ_ YW~|o]?x^ᯛ `ʼn;g)T@vWn]>&4lp+$D̢1l|ȨF%-}.9[}w~ ԠLM9hСablfe&QoW!s?wjLK?s7yO>(=C~_nyǜu?v3vyo oI@qV-jeES^[9WoSܝh"l2C1a͔CiJ@3:Pճw=/7ovuk+\V;lDgն<[A+rX~d;m!_s8ݖ׷;;.0llUC+?i#_crʙ1~C.\–q ul8Hܶ2m`ܻM3Tov|Bs rɵ"oLS- DКw=Tv@f'6|YlD͓Y%׵-#Ѯo%:&!3o%\J<02;K87>^vgƓ# ;ݝmz^Y6=PS39U%~ &f# }o!muH;ʲŇ˷yvP+&.7e[3'vR4Yj̗IZ`e˽3o[WU{ m[sUbۋZǾۆl6~9'V*.\S2<Sd*zY[aŶ`]C$n.v^Ʌ dng>ەZ,Mmϑ :n6nϦezWqUJ4! ۇ4R! =>>Fn|Q[{pRO17ƕ~._I''00k=b՛o}Osðc2'o\3}ݭQ^2 . R1yKȣtAݿ-uܾw!`?1Whn|gzUo[ECWwjUIן)^h#1ɭ!/Z np;o;ΗŻkXs."6E`Z1 עӐ9Kl8qd q} 2Stt;#j>;խabONŗ=fwP1j)l6J̶|gV2`y/0E˛6+ԫ1? 6}KW c\KoKͨ2ۅFw–s*TԞLיuDx .kCzWXhy۶gLu|%TnupǺl-S* PRaLnT+c+*xl.v!.U=|; !_L̎뱚U=4hm:ٯ"y)$:>%(n}X'p[ȴ ^˒4kƓmzDx \ 'NqamP7nyN݅=j7%McSڵj%STy qXymvCg{w/w=wSW5r̹u erծˊsOm=DhEҚRb#n)QOxtվQwe]I}wCa'"[ۂ-z}2UuKP$㜉ԧ:mc<Ý>RoL?wu|%ҷ&K y_!y9 ??:tq3(UU-lkS'ɸ@jdzQˬR] EVPW1DJq2n:,c|ǻ̑;y{X,ۂ.u.b˕u.tKBjQ"[S園S`ٮdNبeJ&9Ơ ~0a(Vm٘L+Jr*vڑE( x0+tp˕ n';wm-ޜMOxX>{#2%jgb2M[`K*\5@8l'e=0u+w ֘鳾{y܀:R*Ya]"Ӧ%ktynlۣ65,3gU}{GYrb;ge'TKwǘ.,rpܚV]Tr,!dp /ԺU,xՉ>s׽~W5oTh yx?xrrx?)?ilbT׬,z$Ԏ.UH٠\U1pU:]JwSrGZq8àd驐,N67QYBӢD㏙W!Q25ϸo9ms-7-%3CihO.J鯽-;MZM8ku-7k9S$8]q2E(}bۏI[DKOK}3KUB^u %Y,u.-&f#]'܆o$x`Yu,dzwM;#oKxn;\[d7}Rb+*Y䛂ZuBӱl{j0O̓}LhK;[aֶaGL{Cb#S.T[>߃F]NK"u^LUʐ_ykW?!GRj29͖qa'0[npcDvV)qz9R)PۨM^aJx W] r>];eN3vxdmĘ(5W2K1䪖weF{mE/QP6\u54x5[hۮ-Nk”i[lUgL]J}5 S:EhiUrgHl!ŒJ$pe=q^b͵Q' ?6|R\,JA ڵ"TDꈭ:ymg`B5t%M] <N_zv2_Ortٵ/i/ReӮ*7[qүqEG* m"[I:6e^p"I$jԴęh!m)]GZkcjS!{e^z}+Cѥ9;R|/ֱeiUԏCNu2Zhcٗg$ݭwvr P8*7/Lk~I'Km1+MW%Bk|oOm>-#qj*|Dbѱkn|n{v#jĮqNpMIUm(7Liz;{ҜݞڝVƚVϬ+sO!OstGvxӉ']uӎ4g_ 1^-8ۦ k!)Ύ5O;YSB#2Zzχ;<.ֵOtge~.(RC#wFZeGZٸ6FFJ4e2ˇpJT$[wgV)q6muDGJ56q\I!̗ y/I~RtJ9kJ]Iy*'FN0s.[l!fw'y(7$œ WƫgyΙdMEU JQJv̋vmrۖ.jWR_M֨djYgSj0^\y'EoECjm$ IƩK>Z28J2TiJ2N#}.s cArl嫶nB.FIJ.)۔\ZiM>/hLĸ=C1s[?YMqp|94- 鮝𦔽/k^#NT(Y LS$6˩}{;5 )B۷W$qpN)qqoot}ZDVә;7TiK|6f3h$dԄ}fqݡ>Nb򗉉+ͶO]>ߡ_VtYf79ڰիF sq~prս|QM)g%l0ocJȨHz V;Bb/kLAcfPJ,ԭ{ƍgpjNR6VSI*$!yV足jᇑ.](EܣqM\qJ2eZT).<9UB/(B0j)mtKEj#׿fDI-=rZړj|'Nڤ]k*i$5qt"ݙPM6E4ke^Z8ۏhz$Q(R Ay2zfRñnpnkbkI:=j &ΝșW?׵d{+ύM'??XqeeĽ.[o=UxFS=ӷdZwenՄ]_X=ĭVa* pKs0ބۍfJ3 gz̚i|wnxtjc¼5${(1fXQ65ȼb̶Zkn>%FQMJXӡ{TZEVNᖣimT/37cNJUPnP҂ZOE~"-Rc4^b- FEͧtf5[)S!OZIښݲ͑;tvܡ+N)AR=hCNn;wL16-:特7M$=Tҕ-.R[HٷnXk sn[ҞD-0WS9p9:-Ϸ-jѬNu{ҹfv)[Ľvwfg(ٷfe+0mYj8Q1\ݧg]Eǎvڿc!4#j5̋C2"}BRriFp7=ô\TZ:\BLfj#I22װ<;صZl j 6:l"6]۸ K'6RTѯ^ئOԓV\?$x7s#r:Oh{ց=MmuHԷd{pN /܅:UE#Yy+(SgQ(Щ)RHzw>^Ѿݻ>mK&^ '$Jۻ&w%F|xfz%˳ L~3N?Cy9 v w/{ƿ kz3x> sXv}vP"@WyC z`'톽Dw%-tt yVY\wmuPYQA0iG-2JP,6/gˢ]u.-n!Zw.N7Q]Df}Q0({a\@=i_X7gFǘ8^⻲}G MZ1)WEfO12G+=-B@z\`||w6ċj߬m}UwRox֢I &c~XGP6Qndpvܻul'V7^FJt^{b^B(L~sѣ6@߿^xqU!ڙ5|Vpvef-uӥ^3  FSDɯKD%0r}FF穛r7 +o"V8tv̖NQU!5uFd"bCr^bJ=֤fM#ʳԷP0O-9xRBm\=`r-:;~3Tl(nXtXi%2Vٛ#vwqƴ`L@"H‹qW.j,JM5B[)WܺUeZFqc'V˷1W7V̾-MHФwn8N;HPSdݷC7&2j.W\τGŎ'Vb]c.x+Rx1%C2T{myg[qU|+m:M:շ8҉yWd)ՋWS%%:iqlʹmGwݹ WnNŤѩ5(9hTٵDdGUi-)vSs2 2{OnT$Xck n:¶(lASLeȔBjμPpTb2~N2~%^k[ܗ[Jzs0ӓHBKq[}JَA-$dFQgjxxFv4r/x*Rm% `4J(&iv7SkԲmSH1YWmx 8n.k']:Z˭_W >ڃXЩ. jTq%Aā[E}amc]D:rmHRiu:uӚӢ\p(5-q%e)(۬ҖȽIf<߽pr&ݫVfY91q2ĭEQgYbTGQ&,yL+N$[q*RVۉQ=FuTܻ>f>f㋳8N6$܌n)9&»iˤsX,݅܍ȩv+sRTpO}d?Wn/Inpȸ%O]StQO|v5\}7Zwb.AIVK^:wb{[uݯcytO߶S<{8KSRׁH̏N7ۚ[xkwYy_'ZӵF+>쌛ZUĦreE9F[24De{}@:ExWs-\ǻ7K-\JNvEk%:s˙#κ].oͳ;լ7wB6nwu:$L; DkI#Wz.:Xp(˅v$Sq,wn\qIN-e<5Oe+vuYTpcojUI_ާP8 O 7&VL8z$_B-H-[uh]T{|8=qVRN-:Ij:7PUtXϷmy鉿:RIM~33ӸS2#׳GdŲ5+/Bx{(WzȨ5Y㞎#|˖+ ط.|e<o/rߔX>7s}VE.OVti׽ .5nNJO"95{#q}Ay9do]R"M6z\tnNS-D!@3N_jicWsy*5uٮRcWv/.,j}=S)j5C^> Ie =gu9ӛqjtz]۪TMoߧI!Ǧ¶m:,"[L!{qAv-o 3{"KʼnrIkfٶj2ƙ؄S`7` k6jzޞ?e5G&6uʷ2%ԒRKE*G\Npom F/V |C0.q_eenƣ<5Oh'67ɪn[SĽ{ڔjǘzs;~׌(ۂ`ܢ1ƣ` _l9Va6%UQWh~P~\F^ZHR@:ۧCJ{ôGeBh;~ۧnU J\O+n2 RҠ)ng}Kh{5+S×ܛ.1ZjG)iRȤIN 4%{oΜ/eO[Nffd ĹK?nnԼMqX'܌nZvq<ķbFnͪaQ`5 s,M_լ?-@_{w{ӺձJ}GF[%v\5[ŒGkOw/ΜM9rjË%2+rd~+󲕛C9U۳r[aJǭm|˒LAʨSCq[XMۺoubfp:t+ΤĻo ][ zt-*67kvS7D·MMCQXm;)܎n_h%]4ܙnRk!]ڵsDUF"`R, &#R_*[z*ZqFXɻ]7|۵w+'pFDەs=r./ᐚm3Hשy yD"jHCr':sA65نѮ^o1V/ f;nFr3VM)e*- s D'H݅fӧ\*޷[k<7u<-]֍Q8R h|p=WlW3s%Q %3l}@U-K6f-NϿu|ڴmWN׮[׸F*mW\%r! C78:޳vBG7ŵ.JթԚ2x)ST!řn~9 W:Wpܢ件{xf8ٳwKE ҰWxVB\qBZ 2wMb[lGSnyԚ~z9ZmያvoN2Afnݽjf>)j3 !;gOYʹK" Wftڎ+׭b*2ϻK>ۢӱeyԪXISUm[z+ugX%0lϏnvg!;t{BqPj>PyvR7Cj]O%+ݲ :qiMj6W}3vC/R=4Som]ŗ=ю, TF6U_-\6MyskwMr&Q\wjKܩyMϣUj0*}RZܷSdY3>Zjqj6TgzpA/M`/Cmл,޻feE[/+uk^Vs1W$G(JsW2ٰu*߻q*Y޵.Wi:ur5T),=0uRmho.twܖiYwrWHntvEj8qhf`Ͻpf(R&>Ki%I7$QӖm-2 ~yߗQ-앑/ x[k8nw.c㩵k}]FkbJl:{.(˩n0Hqvαp7 귎.Gupx[N`Yq'+ruU7[ү+>!xrȫoSo]OC# d^Q]\>!ƛGw^Mx"-+%vdX-:M2UR%d>%l ioSu6lsj7D P>XxHz Ukà(n^Q V>5cVtWj SEiJdznyej[lE' 3kuٌNn4JW)gB {4 j6&]' m-(ZMEz8cz>WZ6#7+[,MR-Z!4ܓtCyE|umj1ƽvƷV\;%>Q :#Le(iVz5 4ũۤUWxX ^(ҔsլB2w-V ^R+; ˂M\z+Uwr+RWY⺧~ Q*JcYSNSλUd8in=v K낫k\IRרSUaCFmϿ5̗P|u ZTԕ}>oYѲ1sfP+sQkX8Gb~6r,s>^\,mGL+7[n-E\.Fqḕcl*Jmjb5 ,m]c}NXfeVlǸJ5eˡ$4%g~N p4Y*WwW٧<8v#;qԩTut,m"#Y D\5V`\\Lȋ];LȇiS6ϝZ l>LruR\v=ǘϔDg=ԈdFZ+M{=|,[;0>RiSi4,S5}yxw&(E7&fݙ4UՕ! ~'Id)]ǽu2K-fޭ \08Vڅ쓬=Vy^^ IhyKR-B#Ըr=]mܻӾ'*Umkoy rTqT_i,/8Q^<ݤ|4ԻO(܄"'5N~#m.(Ҿ2i6Uev&I*<}҄$eNtÛzyWJubW^iBW.܅Wڮg]irO6Ve90sgv.+sV޿aޔ[p?3q*FutUo*eL\KM'EG*ZcAFfG5J 5jj=MJ3OK:k˝'NMB7m3uFҕ\-Ywg%PRqMIyZGY9|μvn߻5cWݷa^+X֥vnݘ\v7m>Fgzv"-;Ew֝}1|RjN𿊀7g#֟*GQQ|#/bo]p$>_Un9гUbn9׃ErQBU-^vDmVh'<R[fdHT]*~}3j;nvjc7s-rӳ Y8[n[1pJx kX[Jk9Mn!_Nю6x:iZ˦U |߉^Ԛ݃hYxk &U^bwKk.[jE+P(˞=9j@snCv7%c_7=xǁ<l {t'酚+1F‹l׭:ݻILruǶkL-L(K0L1&>wXB(pm;1fpnlp֓%Skidkt(U +xulo'/ڕeN r=^pZZ:Pnj8Hf"48ijY[ N[yZٻ+=  ø:3 ?^ܷ^Sr#YK[UF?CuhC b]GM')mڏsNrܗI]ljq6VB. W,UK"YX5{c >Iqā> T:n!,5l2VzCl|+I[*SrjnS6٨y+x,@>П.g+!rn9>N|W>OZT_ut Y""v7|sfި;Pclm EùN,{'fNT%U&LfH8~1v>Il}统u6P˗c(WV~H^bMU.o*oOF0N:_:6Smr_.b+|ݶYY غF,mwjv>f*>QM뭱Sd:`N{l/⎱;n-z~"Gze퇎J5S KG9!Gn;N1 ݎ h6m|S?ɂ5'WOÞ 7|7^ao @mxGmi^jϽ>01Mf0լD3-2T. VXR"ɥV Kl J O7|u?bvа;6.eߓ|[1bmRr,eRz`z 6܎-ͨku͹Fː dPhYgZUj}nvX;z=gVեTv_J }\1n7w2J?ޘγc\E 1Aޑzq;\r]]\Y&[nsNei\uURje*Qk2CSl*xJz-xٶlm+|UjUؓ`Ladqiĩ!Gd\W~fz;Tn*PdRM&T4`չSWq5k훶(N"Ӎ% V]֦wb.nUO!u*J&Oӕ2e|Z=eV쫚΅g#+/RW:طnbi*Wyo)p{:ETKؚR(RY+r웓r(IF) VmȵNB:h Q1ғ|u8E]{,'$-TR[j49l*3"I鯴zhd>Q+\BkNF=.$ZR4Nwհ(IpNi.(Gi33#33e$FXK*NdWrud[r{xnk$v2ıh+J1TQ[#JQl[tRO]LHKٮ NӍnF񨔤֞Em'MILB"ԋ%dBŋ+p̿_17jzT~4pc Vo\ƹb9Rq-'1j;8ܗ)hE%DZKS<璸Bu*%*Yw5ڻ9ۣ^z4U; Ñk\U(o~G?VUĎ:?P?_F_Kߤ~ᓾI |pr.Ok\SklRhҪz{­P .}SktZ7UQ4ڌIM8̈eaӊJZ%FFZu,KZvln廐SNFIVtuNi?CM5]+Ph,{jN JSR$IS^tSUVrORYu.9WyP6 [Kiu m!X|]Y79ӄ)\ģ)pbڳr%*&ꑶ_-H*dzk)1 V3')UAϹٶWRxe'պn۫h7AR9 EAJeGLms!%D| A 5]/Q3eb̄vnVn%za\m kZnv([emqrIҕij|""><hjJשvvǕ|Pޟs}V~2&Z?+2N&Z4w@)4iSڪ_>/JN9Hiۏuf8'It[ȲR.hZ$ȋ_Y ~U<UUO*6b)Ovzڜj\R̋.$FsQuҊj^נ䈈y<zZIuP[}Qm=C?zN(Exqu/kn S-FzKZzOסӽjJ\)F3b!r5ٝ|;6 o=-3*λ]αb\abqRi-w޵⦪~b8Kpo)Z=>)ғ"5/GTZLE-輵f7ݘ۹~+&+w/7GFI:l33fg.N~۲\2|*cnermnnM+Fq"ѪIz%j =YW8@~gc/~?N'?)«qȸs➟n=k" X“m֮VreMh2[uݖ] *FܖN)MȐ`f0 g,C9̑o;ddudJ=In13:ݒvvdMUEJLp^,6t-@͐9'{7m{-3,>hnF;ѰM)->>+Ěz!R* :`e--m7nB\u{b U>[8֪]6^ߤLʦ\DFNo$$dͶlgno8OrsQ\l̯hRo8tuNo+ CTxu!2[>ctFpeޓƻֶR"3QrQuOѳgwQr;S~)6HhZw/GgVTmUf_yt7%$];zLWF̰xy2Ʉu!MCmš_0[W6jf#a-KLi+3Q7c^qg%s<1aYIQeZf+}>;S6L0]Yu_h9߻<ƅpmiM$AVvŚ,*#t2.8Y)-Zhshü97/#Oro"u^/uFgWɺ,p:6a,^x%$Yve^3PƗMnTP&yS}OJ '덫MH^:rXԴJۋ/rI;S*,+yz1hv)Qw^ڍJ2oL׊q(\fDj:^T%vOadɂnS}ZO)N*λdaȜkG_PIEO}нa(^iQX᯦-7^)%g'SJx(.S9zVɴZ{E ))ۅi/s7 VIV-|sj0*UBTHIqRf>FP$KqN0 R̻8j\GcC}IUz\i 6F)Q{Gҧ3qSzKj-Az VЛS-zy:8*mNk|D鿓ND2u+0Yŝ7kqm·?8Ib]u>˗^_>(]vӋzv+ݩ){vZrJ2RQ몋C$z [,pp,8mڊbR]Il .f~d/ݓs㓓mͶ{mgjQwn=Oic9ܚm4Q/6ݨ[TƧ?nԶoytf{@AzT{e{[O'ZRZt~AGD?s3􌿂ՉIw'|~U\ w~di:Kޱ)U/sU%njѩ&GSP^ǝd)..!^U` 1wX[aԇSxoFV6_扐)T 2Mfd=ۖͭiZ7KK Bi9%7@<3<ճԻU,},a}FRqɛr i@ONJvK KLN M, ʖv0n-]DwlI-X6ܶ$Jʴh5O+mOI+Ra瞠\ MG7BفjYo1#͖0V`Ѱ2M?c8>-Crt*JkIGS:e#hPKx[鱼>{5m;wcն&>j-M֥^َ) 6yȜl_w{-ō̱r> U=]iw3)r*]:K]6BdCTZ|>gf}LW}[$'Y5 &c -j.z6R 67MԷFMnÌwI7w5E}o޽+K ֵy4܌ȥW"COyR[q5Ӱ͙f[v"_#q{MV6܍3"u9BK(41ӯqˇc${ߝCi6I(OmθzҜ5k^:>Jzw.>qV8{vU[ڶEm|DžBz].KHjI]x;Mɗ{m,qZXr忇2u^RO2Z}ZێS[2Jen!*NDcrBUً4<ǼMҲs1Zw57c3&ĖڻzmP*FuJG1-dN:|OU}ҵgi2t~F^^Z.VxjvŧnNNh<:]^~NN+ge^g.SԔGFe߯'[vn'(ScJ]kܗ7eJOlRrfziݮq̋S"\*U<*W]k$FջV}? 7g#֟*GQQ|#/bo]p$>_Un9;l S VvQU%OLU{οmU6bZ1MTx%!֙Q7, J=!3 ;Q,ڌ;6ͱ݅q^&ߔ·n #WbwӖX.HtG)N&d̵zpI,n cu ޖUj+VXUp[w]N o.J6Z8Ts&utxln;~HPHS/xw`G\ʡ¿rj Z^vt"[L:SD\h0sUwR,}[x^X,R2Vn< ]2YDr[SRKs8tXb̷G?Ps Tv 3be,zVz D[/I.KOEQrm'$7|[J>r S`5յwT#\w1FTz\Ԛ &"ׅhSHrD\'r]~/>p;:Piuu:"9ő=tTaS7V2rӷk7mb[^WmPp*[y.Þ6f]cizJCgRR@UVl큝.WJP1N{/\whZ ػϧӱE7|E֫Sί.x-Y&pi%v''-x6r'Ws*6=DwwUu]=C?MK [yrtܒG$!WGqJ*%SAz ED[^)/tė/g=#Omd.|^n/sl׉g DZqemqowݮRzUܜ=ڽ-o/Iۖ;qVʘgPp|mm;6zGl9.8pwWgsJ2qPbe}}UpNjٯ}7TMQKrؽtEx%v w߾8%|j;~|}pK]ơ/ w߾8%|j;~|}pK]ơ/ w&~e_H 8PL7:%ʭ5Kw&U2vwR_+rm'}C7#rWoO&HoG?M$UR7{FU]u ;# !Wk`|W>׹潇9Vn)6)*ҹ{%qV4q>W1vi#T"Qk&GwxcJBJ- Ϸ^ˁxkU}ԣ/3.;]J=<*)cS)ROK9H=,r zX @)cS)Da^ԽQ gxJI=w֣gf*TRj

*Corresponding author Hak Soo Seo, seohs@snu.ac.kr, Tel: +82-2-880-4548, Fax: +82-2-877-4550
• Received: January 6, 2022   • Revised: February 10, 2022   • Accepted: February 12, 2022

Copyright © 2022 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 7 Views
  • 0 Download
prev next

Full Article

Download PDF Download PDF
  • Doubled haploid (DH) technology enables the generation and evaluation of new plant genotypes in ≤ 2 years, which is in stark contrast to the 6-7 years required for conventional breeding. Recently, a few proteins including MATRILINEAL (MTL) were found to trigger haploid induction in monocot plants. However, MTL function in dicot plants remains unclear. Here, we investigate the effects of Arabidopsis PATATIN-RELATED PHOSPHOLIPASE 2A (pPLA-IIa), a maize MTL homolog, on the expression of genes that modulate pollen development and fertilization in Arabidopsis. Quantitative real-time PCR analysis showed that transcript levels of four pollen tube growth-related genes and six pollen guidance- or reception-related genes were increased in the ppla-iia T-DNA insertion mutant compared with the wild type. In addition, transcript levels of four mitosis- and meiosis-related genes, two hormone-related genes, and a calcium pump-encoding gene were also upregulated in the ppla-iia mutant, whereas expression levels of genes encoding a synergid-secreted peptide (AtLURE1.1) and calmodulin-activated Ca2＋-ATPase ion pump 9 (ACA9) protein were downregulated in the ppla-iia mutant compared with the wild type. Taken together, these results suggest that AtLURE1.1 and ACA9 play positive roles in pPLA-IIa-mediated fertilization. Thus, pPLA-IIa controls fertilization through the modulation of pollen germination and pollen tube growth and guidance in Arabidopsis.
  • Key words: pPLA-IIa, Haploid, Patatin-like phophpolipase 2A, Pollen tube, Synergid, Fertilization
Phospholipase A2 (PLA) enzymes participate in numerous developmental and physiological processes through the production of free fatty acid and lysophos-pholipid signaling molecules in animals and plants (Meijer and Munnik 2003; Shimizu et al. 2006). PLA proteins are classified into four different groups: secreted PLA2 (sPLA2), calcium-independent PLA2 (iPLA2), cytosolic PLA2 (cPLA2), and patatin-like PLA2 (pPLA2) (Six and Dennis 2000).
The pPLA proteins contain a patatin domain. In Arabidopsis thaliana, the pPLA family is divided into three subfamilies: pPLA-I, pPLA-II (a, b, g, d, e), and pPLA-II (a, b, g, d). The pPLA-I subfamily proteins contain a leucine-rich enzymatic domain at the C-terminal end. The catalytic domains of pPLA-I and pPLA-II subfamily proteins contain 6-7 exons, similar to the animal iPLA2s (Scherer et al. 2010). The pPLA-III subfamily proteins possess only one intron and harbor a unique feature in the patatin domain, which distinguishes them from other patatin domain-containing enzymes (Scherer et al. 2010).
In plants, pPLA-II was first described as a lipid acyl hydrolase and potato tuber storage protein (Senda et al. 1996; Shewry 2003). The Arabidopsis genome encodes ten pPLA-II proteins (Ryu 2004). The activity of pPLA proteins is rapidly induced by different environmental signals, and the reaction products (polyunsaturated fatty acids and lysolipids) function as secondary messengers to regulate distinct proteins or downstream processes (Scherer 1996; Meijer and Munnik 2003). In many plants, pPLAs are induced upon infection to help control the spread of disease, whereas in mammals, pPLAs are mostly involved in lipid metabolism and turnover.
Recently, a sperm-specific pPLA2, known as MATRILINEAL (MTL), was shown to trigger haploid induction in maize (Zea mays) and rice (Oryza sativa) (Gilles et al. 2017; Kelliher et al. 2017; Liu et al. 2017; Yao et al. 2018). Haploid seed production is an important breeding approach, as it helps achieve complete homozygosity within a single generation using the doubled haploid (DH) technology (Dwivedi et al. 2015). However, Arabidopsis ppla-iia mutants did not produce haploid seeds (Kwak et al. 2021). Instead, Arabidopsis ppla-iia mutants flowered later than wild-type plants under long day conditions (Kwak et al. 2021).
Nevertheless, the function of pPLA2-II in reproduction, specifically pollen germination, pollen tube growth, pollen reception, and fertilization, has not yet been identified. Therefore, in this study, we characterized the role of Arabidopsis pPLA-IIa, a homolog of maize MTL, in pollen development and fertilization. The expression patterns of various pollen development- and fertilization- related genes were investigated in the ppla-iia T-DNA insertion mutant. We found that only AtLURE1.1 and ACA9 genes were downregulated in the ppla-iia mutant, whereas other genes were upregulated, indicating that AtLURE1.1 and ACA9 act as positive regulators of pPLA-IIa-mediated pollen development and fertilization.
Plant materials and growth conditions
Arabidopsis thaliana ecotype Columbia (Col-0; wild type [WT]) and T-DNA insertion knockout mutant ppla-iia (SAIL_172_F04) were used in this study. The At2g26560 T-DNA insertion mutant ppla-iia was obtained from the Arabidopsis Biological Resource Center at Ohio University. To grow plants in vitro, seeds were surface- sterilized in commercial bleach, containing 5% sodium hypochlorite and 0.1% Triton X-100, for 10 minutes, and then rinsed five times in sterilized water. The surface- sterilized seeds were cold-stratified in the dark at 4℃ for 3 d, and then sown on Murashige and Skoog (MS) medium containing 1% sucrose and 0.8% agar (pH 5.7). To grow plants in soil, seeds were directly sown into sterile vermiculite. Plants were grown in a growth chamber at 22℃ under long-day (LD) photoperiod (16 hours light/8 hours dark).
Quantitative real-time RT-PCR analysis
Expression levels of ANXUR1 (ANX1), ANX2, CHROMOSOME TRANSMISSION FIDELITY 7 (AtCTF7), AtMYB97, RAPID ALKALINIZATION FACTOR 4 (AtRALF4), ATUNIS1 (AUN1), BRASSINOSTEROID INSENSITIVE 1 (BRI1), centromere-specific histone 3 (CENH3), Centromeric Protein C (CENPC), CLAVATA3/EMBRYO SURROUNDING REGION-RELATED PEPTIDE 45 (CLE45), CORONATINE INSENSITIVE1 (COI1), DUO POLLEN1 (DUO1), LOST IN POLLEN TUBE GUIDANCE 1 (LIP1), LIP2, LEUCINE-RICH REPEAT EXTENSIN 10 (LRX10), MALE DISCOVERER1 (MDIS1), OMISSION OF SECOND DIVISION1 (OSD1), POLLEN RECEPTOR-LIKE KINASE 1 (PRK1), and Rho of plant1 (ROP1) genes were examined by quantitative real-time RT-PCR in WT and ppla-iia mutant plants grown under LD conditions, as described above. Total RNA was isolated from the flowers of WT and ppla-iia plants, and mRNA levels were analyzed as previously described (Park et al. 2011). Quantitative real-time RT-PCR was performed using gene-specific primers (Table 1). UBQ10-specific primers were included in each reaction as an internal control. All reactions were performed three times with three independent RNA samples.
Genes encoding pollen tube growth regulators were upregulated in the ppla-iia mutant
In previous study, we found that pPLA-IIa loss upregulated the floral repressor FLOWERING LOCUS C (FLC) expression and downregulated a long intronic noncoding RNA COLDAIR expression, resulting in late flowering of the ppla-iia mutants (Kwak et al. 2021; Fig. 1). However, there was no big difference in the growth between WT and ppla-iia mutants at germination and vegetative stages (Fig. 1). In addition, ppla-iia mutants did not produce abnormal seeds (Kwak et al. 2021). Therefore, we focused on the analysis of the expression of various genes involved in fertilization including pollen and pollen tube growth in WT and ppla-iia plants.
We first examined the expression levels of six genes, AtRALF4, AUN1, LRX10, AtMYB97, ROP1, and CLE45, involved in pollen tube growth. The RALF family of proteins include cysteine-rich peptides and the ligands of receptor-like kinases of the Catharanthus roseus receptor- like kinase 1 (RLK1)-like (CrRLK1L) subclass. AtRALF4 strongly inhibits pollen germination (Morato et al. 2014), and its function depends on pollen-expressed LRX family proteins, which play a critical role in cell wall development (Mecchia et al. 2017). AUN1 is a phosphatase that acts as a nucleocytoplasmic negative regulator of tip growth. A recent study showed that AUN1D94N and AUN1H127A proteins, harboring substitutions of key amino acid residues in the conserved catalytic domain, function as dominant amorphic variants that repress pollen tube growth (Franck et al. 2018). LRXs are chimeric proteins that contain an LRR and an EXT domain (Baumberger et al. 2003). The LRX genes are grouped into two classes, depending on their spatial expression patterns; the first group of LRXs is expressed in vegetative tissue (Zhou et al. 1992), while the second group is expressed specifically in pollen (Baumberger et al. 2003). LRX10 belongs to the second group, and the Arabidopsis lrx10 mutant produces abnormal pollen tubes, with an irregular deposition of callose and pectin (Sede et al. 2018).
AtMYB97 is a R2R3-MYB transcription factor and is mainly expressed in mature pollen grains and pollen tubes (Liang et al. 2013). Mutation of the MYB97 gene causes the overgrowth of pollen tubes in the embryo sac, disrupts the discharge of sperm cells into the embryo sac, and significantly alters the expression of a group of pollen-expressed genes in mature pollen grains (Liang et al. 2013). Rop1 is a small G-protein molecular switch that regulates pollen germination and tube growth (Kost et al. 1999; Li et al. 1999; Fu et al. 2001). Actin assembly in the pollen tip requires AtRop1 activation (Fu et al. 2001). CLE45 is a small peptide composed of 90 amino acids that prolongs pollen tube growth at high temperatures. The CLE45 gene was preferentially expressed in the stigma within the pistil at 22℃. However, upon the temperature shift to 30℃, the expression of CLE45 expanded into the transmitting tract, along which the pollen tubes elongate.
Based on these reports, we examined the expression levels of AtRALF4, AUN1, LRX10, AtMYB97, and ROP1 in the flowers of WT and ppla-iia mutant plants. The ppla-iia mutant showed approximately 2-fold higher expression of AtRALF4, AUN1, LRX10, and AtMYB97 and approximately 1.5-fold higher expression of ROP1 than the WT (Fig. 2).
Genes encoding pollen receptors were upregulated in the ppla-iia mutant
Next, we checked the expression levels of six genes, LIP1, LIP2, ANX1, ANX2, PRK1, and MDIS1, involved in pollen guidance or reception. LIP1 and LIP2 are RLKs that localize to the pollen tube tip plasma membrane (Liu et al. 2013). The lip1 lip2 double mutant is defective in pollen tube guidance triggered by AtLURE1. Interestingly, LIPs are not direct receptors of pollen because they lack an extracellular domain. Genes encoding RLKs such as ANXUR1/2 (ANX1/2) (Boisson-Dernier et al. 2009; Miyazaki et al. 2009) and MDIS1/2 (Wang et al. 2016) show the highest expression in mature pollen grains and/or pollen tubes, and play important roles in pollen tube development. The anx1 anx2 double mutant is sterile because pollen burst immediately after germination (Boisson-Dernier et al. 2009; Miyazaki et al. 2009).
On the contrary, ANX1/2 overexpression lines show defective pollen tube growth due to the overaccumulation of cell wall material and invagination of the plasma membrane (Boisson-Dernier et al. 2013). Plants expressing kinase-dead dominant negative MDIS1 (MDIS1DN) variant protein exhibit decreased micropylar guidance and fertilization efficiency, indicating that MDIS1DN interferes with pollen tube guidance (Wang et al. 2016). PRK-encoding genes were first identified in petunia (Petunia × atkinsiana; PRK1) (Lee et al. 1996) and tomato (Solanum lycopersicum; SlPRK1/2) (Muschietti et al. 1998). Although similar in structure, PRK1 and SlPRK1/2 perform different functions. PRK1 plays a role in microspore development (Lee et al. 1996), while LePRK1/2 participate in pollen tube growth and/or pollen–pistil interactions (Zhang et al. 2008; Salem et al. 2011; Gui et al. 2014). In Arabidopsis, AtPRK1 and AtPRK3 are predicted to function as the receptors of the AtLURE1.2 peptide. In addition, AtPRK3 is involved in pollen tube growth, plant fertility, and plant reproduction (Takeuchi and Higashiyama 2016).
In this study, we examined the expression levels of LIP1, LIP2, ANX1, ANX2, MDIS1, and PRK1 in the flowers of WT and ppla-iia plants. Compared with the WT, transcript levels of LIP1, LIP2, ANX1, ANX2, and MDIS1 were approximately 2-fold higher in the appla2 mutant, while that of PRK1 was approximately 1.5-fold higher in ppla-iia mutant flowers (Fig. 3).
AtLURE1.1 was downregulated in the ppla-iia mutant
Sexual reproduction in plants requires the directional growth of pollen toward the embryo sac and the discharge of two sperm cells into a receptive synergid cell (Wilhelmi and Preuss 1997). Emerging data indicate that two synergid cells adjacent to the egg cell emit a diffusible, species- specific signal that attracts the pollen tube at the last step of pollen tube guidance (Higashiyama et al. 2001; Higashiyama and Hamamura 2008; Punwani and Drews 2008).
Research in Torenia fournieri showed that LURE genes, which encode defensin-like cysteine-rich polypeptides, were specifically expressed in the synergid cell to attract the pollen tube (Okuda et al. 2009). Consistent with this finding, the injection of morpholino antisense oligomers targeting LURE impaired pollen tube attraction (Okuda et al. 2009). Homologs of TfLURE peptides have been identified in Arabidopsis, namely, AtLURE1 (Higashiyama 2010; Takeuchi and Higashiyama 2012). AtLURE1 peptides also attract the pollen tube; however, knockdown of AtLURE1 only partially impaired the precise guidance of the pollen tube around the ovule (Takeuchi and Higashiyama 2012). Therefore, to determine the effect of pPLA-IIa on the expression of AtLURE1.1, we compared the expression level of AtLURE1.1 between WT and ppla-iia mutant flowers. Results showed that the expression level of AtLURE1.1 was approximately 2-fold lower in the ppla-iia mutant than in the WT (Fig. 4).
Expression of cell division-related genes was upregulated in the ppla-iia mutant
Proper mitosis and meiosis are important for cell division and equal separation of chromosomes between daughter cells. Here, we examined the expression levels of five mitosis- and meiosis-related genes, CENH3, CENPC, DUO1, AtCTF7, and OSD1, in WT and ppla-iia mutant flowers.
In Arabidopsis, haploid lines could be obtained by modifying CENH3 (Ravi and Chan 2010; Ravi et al. 2010). In addition, mutagenizing the histone fold domain of CENH3 causes excellent haploid induction upon pollination by wild-type pollen, although the growth and fertility of the DH are affected (Kuppu et al. 2020). CENPC is an essential kinetochore component required for accurate cell division in yeast and mammals. Arabidopsis CENPC proteins display very similar characteristics and localization patterns as their homologs in other plant species (Dawe et al. 1999; Ogura et al. 2004; Du et al. 2010). In addition, CENPC knockdown has been reported to cause cell cycle arrest (Burgos-Rivera and Dawe 2012) as well as chromosome misalignment and segregation defects during mitosis (Shono et al. 2015). DUO1 is an R2R3-MYB transcription factor that plays a key role in the development of the male germline in Arabidopsis (Durbarry et al. 2005; Rotman et al. 2005). DUO1 is responsible for the transcriptional control of genes that comprise a regulatory network and encode mitotic cyclins required for entry into pollen mitosis II and other proteins required for sperm cell adhesion and fertilization (Brownfield et al. 2009; Borg et al. 2011; Mori et al. 2014). OSD1 harbors three putative cell cycle-related domains and is involved in the transition from meiosis I to meiosis II (Cromer et al. 2012). The osd1 mutants fail to enter the second meiotic division in both male and female gametophytes, resulting in functional 2n gametes and tetraploid progeny (d’Erfurth et al. 2009).
In addition, Arabidopsis OSD1 protein acts as a mitotic APC/C inhibitor (Iwata et al. 2011) and consequently promotes meiotic progression (Cromer et al. 2012). AtCTF7 functions as an acetyltransferase. While the ctf7 T-DNA insertion mutant exhibits poor anther development and sterility and defective chromosome segregation during mitosis (Bolaños-Villegas et al. 2013), RNA interference (RNAi) lines of AtCTF7 display chromosome fragmentation and the loss of sister chromatid cohesion during meiosis (Singh et al. 2013), indicating that AtCTF7 is required for both mitosis and meiosis. We thus examined the effect of pPLA-IIa on the expression of these genes using total RNA isolated from the flowers of WT and ppla-iia plants. The results of qRT-PCR analysis showed that the expression level of DUO1 was increased by approximately 2-fold, whereas CENH3, CENPC, AtCTF7, and OSD1 were upregulated only slightly in the ppla-iia mutant compared with the WT (Fig. 5).
ACA9 expression was downregulated in the ppla-iia mutant
Calcium ions (Ca2＋) are implicated in many physiological processes, including pollen tube tip growth and fertili-zation. The gene encoding calmodulin (CaM)-activated Ca2＋-ATPase ion pump 9 (ACA9) is expressed primarily in pollen, and the ACA9 protein is localized to the plasma membrane (Schiøtt et al. 2004). Disruption of the ACA9 gene decreases the growth rate and growth potential of pollen tubes and increases the rate of abortion (Schiøtt et al. 2004), indicating that ACA9 functions as a key regulator of pollen tube growth and fertilization. In this study, qRT-PCR analysis revealed that the expression of ACA9 was downregulated in ppla-iia mutant flowers by approximately 2-fold compared with WT flowers (Fig. 6).
Upregulation of hormone-related genes in the ppla-iia mutant
Jasmonate (JA) signaling is essential for several en-vironmental stress responses and reproductive develop-ment in many plant species. In Arabidopsis, mutations in genes encoding JA biosynthesis enzymes and JA receptors result in sporophytic male sterility, characterized by the failure of stamen filament elongation, severe delay in anther dehiscence, and decline in pollen viability (McConn and Browse 1996). AtCOI1 is an F-box protein and an essential component of the JA co-receptor complex (Sheard et al. 2010). The coi1 null mutant is male sterile and does not produce seeds because of non-germinating pollen, anthers dehiscence, and insufficient elongation of stamen filaments (Feys et al. 1994; Xie et al. 1998).
Brassinosteroids (BRs) are a class of polyhydroxysteroids, which are perceived by the cell surface receptor BRI1. BRs regulate a wide range of physiological processes, including plant growth, development, and immunity, and promote stem elongation and cell division (Grove et al. 1979; Bajguz 2007). The bri1 mutant produces only appro-ximately 20% pollen per anther compared with the wild type, and fails to release pollen upon anther dehiscence (Ye et al. 2010). Expression analysis of COI1 and BRI1 in this study showed that both genes were slightly upregulated in ppla-iia mutant flowers compared with WT flowers (Fig. 7).
Previous studies showed that plant pPLA family proteins are involved in the regulation of root architecture, radical and cotyledon development, seed oil content, and the response to stress conditions, nutrient shortage, and phytohormones (Yang et al. 2007; Rietz et al. 2010; Yang et al. 2012; Labusch et al. 2013; Li et al. 2013; Effendi et al. 2014; Scherer and Pietrzyk 2014). The pPLA-IIa proteins exert their function through the action of polyunsaturated fatty acids and lysolipids produced by the hydrolysis of phospholipids and galactolipids (Holk et al. 2002; Yang et al. 2012). Recent studies showed that the loss of sperm-specific pPLA-IIa proteins increased haploid seed production in maize and rice, although their action mechanisms were not clearly identified (Gilles et al. 2017; Kelliher et al. 2017; Liu et al. 2017; Yao et al. 2018).
Therefore, in this study, we attempted to identify the possible function of Arabidopsis pPLA-IIa during pollen growth, pollen tube development, and fertilization. We isolated the ppla-iia T-DNA insertion mutant, and examined the expression of genes involved in pollen growth and pollen tube development, and fertilization by qRT-PCR. We first analyzed the expression of genes involved in pollen tube growth, as it is the first step in the fertilization process (Kost et al. 1999; Li et al. 1999; Baumberger et al. 2001; Fu et al. 2001; Baumberger et al. 2003; Liang et al. 2013; Morato et al. 2014; Mecchia et al. 2017; Franck et al. 2018; Sede et al. 2018). Unexpectedly, the expression of these genes was upregulated in the ppla-iia mutant (Fig. 2). Then, we examined the expression of pollen receptor genes because pollen guidance and reception are important for normal fertilization (Lee et al. 1996; Muschietti et al. 1998; Zhang et al. 2008; Boisson-Dernier et al. 2009; Miyazaki et al. 2009; Salem et al. 2011; Boisson-Dernier et al. 2013; Liu et al. 2013; Gui et al. 2014; Takeuchi and Higashiyama 2016; Wang et al. 2016). Like pollen tube growth-related genes, the expression of pollen receptor genes was also upregulated in the ppla-iia mutant (Fig. 3). Because pollen tube attraction is an important step in the fertilization process (Wilhelmi and Preuss 1997; Higashiyama and Hamamura 2008; Punwani and Drews 2008; Higashiyama et al. 2009; Okuda et al. 2009; Takeuchi and Higashiyama 2012), we analyzed the expression of a gene encoding a synergid-secreted protein and found that its expression was downregulated in the ppla-iia mutant (Fig. 4).
Next, because proper mitosis and meiosis are essential for normal cell division (Dawe et al. 1999; Ogura et al. 2004; Durbarry et al. 2005; Rotman et al. 2005; Mori et al. 2006; Brownfield et al. 2009; d’Erfurth et al. 2009; Du et al. 2010; Ravi and Chan 2010; Ravi et al. 2010; Borg et al. 2011; Iwata et al. 2011; Burgos-Rivera and Dawe 2012; Cromer et al. 2012; Bolaños-Villegas et al. 2013; Shono et al. 2015; Kuppu et al. 2019), we examined the expression of four mitosis- and meiosis-related genes, and found that their expression was upregulated in the ppla-iia mutant (Fig. 5). Additionally, since Ca2＋ plays an important role in pollen tube tip growth and fertilization (Schiøtt et al. 2004), we investigated the expression of a gene encoding a CaM-activated Ca2＋-ATPase ion pump, and found that its expression was downregulated in the ppla-iia mutant (Fig. 6). Finally, we examined the expression of JA- and BR-related genes because hormones are involved in reproductive organ development (Grove et al. 1979; Feys et al. 1994; McConn and Browse 1996; Xie et al. 1998; Bajguz 2007; Sheard et al. 2010; Ye et al. 2010). The results showed that JA- and BR-related genes were upregulated in the ppla-iia mutant (Fig. 7).
At the beginning of this research, we speculated that the expression of all analyzed genes would be downregulated in the ppla-iia mutant because reduced expression of these genes can cause abnormal or reduced fertilization, thus increasing DH production. However, only the genes involved in pollen tube attraction and Ca2＋ pumping were downregulated in the ppla-iia mutant, while four other types of genes were upregulated in the mutant. Our data suggest that several proteins are involved in the regulation of pollen tube growth and fertilization, although pPLA-IIa is the major player in both these processes. Very recently, we found that haploid seeds were not produced in ppla-iia mutants (Kwak et al. 2012). Therefore, our data also suggest that the haploid production mechanism in monocots is different from that in dicots because only the loss of pPLA-IIa induces the production of haploid seeds in maize and rice (Gilles et al. 2017; Kelliher et al. 2017; Liu et al. 2017; Yao et al. 2018). Further analyses using ppla-iia mutants and lines carrying mutations in pPLA-IIa homologous genes are required for elucidating the roles of various types of phospholipases including pPLAs in pollen development, fertilization, and haploid production.
This work was supported by National Research Foundation of Korea Grant funded by the Korean Government (Project No. 2021R1A2C1003446). This work was also carried out with the support of “Cooperative Research Program for Agriculture Science and Technology Development (Project No. PJ01567701)” Rural Development Administration, Republic of Korea.
Fig. 1
Phenotypes of WT and ppla-iia mutant plants. Seeds of WT and ppla-iia mutants were germinated on MS media or in the soil and then photographed at germination, vegetative growth and flowering stages.
pbb-10-1-49-f1.jpg
Fig. 2
Evaluation of the effect of pPLA-IIa on the expression of pollen tube growth-regulating genes. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of AtRALF4, AUN1, LRX10, AtMYB97, and ROP1 were analyzed by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
pbb-10-1-49-f2.jpg
Fig. 3
Analysis of the effect of pPLA-IIa on the expression of genes encoding pollen receptors. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of LIP1, LIP2, ANX1, ANX2, PRK1, and MDIS1 were analyzed by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
pbb-10-1-49-f3.jpg
Fig. 4
Examination of the effect of pPLA-IIa on the expression of the AtLURE1.1 gene, which encodes a synergid-secreted protein. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and the expression level of AtLURE1.1 was examined by real-time qRT-PCR using gene- specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
pbb-10-1-49-f4.jpg
Fig. 5
Examination of the effect of pPLA-IIa on the expression of cell division-related genes. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of CENH3, CENPC, CTF7, and DUO1 were examined by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (*P < 0.1, **P < 0.01, ***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
pbb-10-1-49-f5.jpg
Fig. 6
Analysis of the effect of pPLA-IIa on the expression of ACA9, which encodes a Ca2＋ pump. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and the expression level of ACA9 was examined by real-time qRT-PCR using-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
pbb-10-1-49-f6.jpg
Fig. 7
Evaluation of the effect of pPLA-IIa on the expression of hormone-related genes. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of COI1 and BRI1 were examined by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (**P < 0.01, ***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
pbb-10-1-49-f7.jpg
Table 1
List of primers used in this study.
Table 1
Category Gene Forward primer Reverse primer PCR product (bp)
Ion pump ACA9 5’-GCAGGCTTAAGCATTCTTGG-3’ 5’-TTCTTGCGTTGAACTCGTTG-3’ 120
Receptor LIP1 5’-TGAAACAAACGCAACTGCTC-3’ 5’-CGTGATCTCTACCGCTGTCA-3’ 149
LIP2 5’-GAGCTTATCACGGGTCGAAG-3’ 5’-GATGCTTCCTCTTGCACACA-3’ 200
ANX1 5’-GAGGCGACTCTCACACATCA-3’ 5’-CAATGACGTTGGAATCATCG-3’ 192
ANX2 5’-GCAGGCTTAAGCATTCTTGG-3’ 5’-GCAGGCTTAAGCATTCTTGG-3’ 146
MDIS1 5’-ATGGGCGTCAAAGTATCTGG-3’ 5’-GGTCTTTGGCTTTCGTCAAG-3’ 138
PRK1 5’-GGATTTAGCGAGTTGGGTGA-3’ 5’-TCTTCTCCACAGCCTGTCCT-3’ 182
Attractant LURE1.1 5’-CCTTTCGATCCACGTTCACT-3’ 5’-GCAACGACAAAGTTTTCTTTCAA-3’ 135
RALF4 5’-CATTGGCTACGATGCTCTCA-3’ 5’-CATCCACGCCTGTAAGGATT-3’ 108
CLE45 5’-ACGCGTTCTCGAGGAAGTTA-3’ 5’-GGCTGAGCTTTGTTGTGGAT-3’ 141
Activator AUN1 5’-GAGGCCATCAGGTAGTGGAA-3’ 5’-ACCGGCATTGTCAAACTCTC-3’ 104
LRX10 5’-CGGACAAGGTGATTCATGTG-3’ 5’-ACTGGACGGCTAATCACCAC-3’ 129
MYB97 5’-GCTTCTTGACTGGGGAAGTG-3’ 5’-TGGCAAGTTGTTGGTGTCAT-3’ 139
ROP1 5’-TTCAGTGCCAATGTTGTGGT-3’ 5’-TGCTCCACGGTAACTCAGTG-3’ 108
Meiosis gene DUO1 5’-TGGTTTGGTTGAGGAAGAGG-3’ 5’-AGCGAAAGGCTGATGCTCTA-3’ 133
CENH3 5’-AGAGATTCGCCATTTCCAGA-3’ 5’-AGCTTCAGCTGTCCAACGAT-3’ 124
CENPC 5’-TCTTACGCATGAGGGGAAAC-3’ 5’-TCGAGCGGTCTCGACTTAAT-3’ 111
CTF7 5’-TTTTAAGGGTTGGCAGAACG-3’ 5’- GTTTCTGTGTGCAGGGGAAT -3’ 100
OSD1 5’-TGGCCGAGTTATTGAGATCC-3’ 5’-GCTTGAATCCCACAGATGGT-3’ 119
Hormone related gene COI1 5’-CTTCCGCCTTGTCTTACTCG-3’ 5’-GTTAAGCCGCCTTGTCTCAG-3’ 132
BRI1 5’-ACGAGCGGCTTCTTGTGTAT-3’ 5’-GCCGTGTGGACCAGTTTAGT-3’ 102
  • Bajguz A. 2007. Metabolism of brassinosteroids in plants. Plant Physiol. Biochem.. 45(2): 95-107.
  • Baumberger N, Doesseger B, Guyot R, Diet A, Parsons RL, Clark MA, et al. 2003. Whole-genome comparison of leucine-rich repeat extensins in Arabidopsis and rice: a conserved family of cell wall proteins form a vegetative and a reproductive clade. Plant Physiol.. 131: 1313-1326.
  • Boisson-Dernier A, Roy S, Kritsas K, Grobei MA, Jaciubek M, Schroeder JI, et al. 2009. Disruption of the pollenexpressed FERONIA homologs ANXUR1 and ANXUR2 triggers pollen tube discharge. Development. 136: 3279-3288.
  • Bolaños-Villegas P, Yang X, Wang HJ, Juan CT, Chuang MH, Makaroff CA, et al. 2013. Arabidopsis CHROMOSOME TRANSMISSION FIDELITY 7 (AtCTF7/ECO1) is required for DNA repair, mitosis and meiosis. Plant J.. 75(6): 927-940.
  • Borg M, Brownfield L, Khatab H, Sidorova A, Lingaya M, Twell D. 2011. The R2R3 MYB transcription factor DUO1 activates a male germline specific regulon essential for sperm cell differentiation in Arabidopsis. Plant Cell. 23: 534-549.
  • Brownfield L, Hafidh S, Borg M, Sidorova A, Mori T, Twell D. 2009. A plant germline-specific integrator of sperm specification and cell cycle progression. PLoS Genet.. 5: e1000430
  • Burgos-Rivera B, Dawe RK. 2012. An Arabidopsis Tissue-Specific RNAi Method for Studying Genes Essential to Mitosis. PLoS One. 7(12): e51388
  • Cromer L, Heyman J, Touati S, Harashima H, Araou E, Girard C, et al. 2012. OSD1 promotes meiotic pro-gression via APC/C inhibition and forms a regulatory network with TDM and CYCA1; 2/TAM. PLoS Genet.. 8(7): e1002865
  • Jolivet S, Froger N, Catrice O, Novatchkova M, Mercier R. d' Erfurth I2009. Turning meiosis into mitosis. PLoS Biol.. 7: e1000124
  • Dawe RK, Reed LM, Yu HG, Muszynski MG, Hiatt EN. 1999. A maize homolog of mammalian CENPC is a constitutive component of the inner kinetochore. Plant Cell. 11: 1227-1238.
  • Dessen A. 2000. Structure and mechanism of human cytosolic phospholipase A2. Biochim. Biophys. Acta. 1488: 40-7.
  • Du Y, Topp CN, Dawe RK. 2010. DNA binding of Centromere Protein C (CENPC) is stabilized by single-stranded RNA. PLoS Genet.. 6(2): e1000835
  • Durbarry A, Vizir I, Twell D. 2005. Male germ line development in Arabidopsis. duo pollen mutants reveal gametophytic regulators of generative cell cycle progression. Plant Physiol.. 137: 297-307.
  • Dwivedi SL, Britt AB, Tripathi L, Sharma S, Upadhyaya HD, Ortiz R. 2015. Haploids: constraints and opportunities in plant breeding. Biotechnol. Adv.. 33: 812-829.
  • Effendi Y, Radatz K, Labusch C, Rietz S, Wimalasekera R, Helizon H, et al. 2014. Mutants of phospholipase A (pPLA-I) have a red light and auxin phenotype. Plant Cell Environ.. 37: 1626-1640.
  • Feys B, Benedetti C, Penfold C, Turner J. 1994. Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to methyl jasmonate, and resistent to a bacterial pathogen. Plant Cell. 6: 751-759.
  • Franck CM, Westermann J, Bürssner S, Lentz R, Lituiev DS, Boisson-Dernier A. 2018. The protein phosphatases ATUNIS1 and ATUNIS2 regulate cell wall integrity in tip-growing cells. Plant Cell. 30(8): 1906-1923.
  • Fu Y, Wu G, Yang Z. 2001. Rop GTPase-dependent dynamics of tip-localized F-actin controls tip growth in pollen tubes. J Cell Biol.. 152: 1019-1032.
  • Ghosh M, Tucker DE, Burchett SA, Leslie CC. 2006. Properties of the Group IV phospholipase A2 family. Prog. Lipid Res.. 45: 487-510.
  • Gilles LM, Khaled A, Laffaire JB, Chaignon S, Gendrot G, Laplaige J, et al. 2017. Loss of pollen-specific phospholipase NOT LIKE DAD triggers gynogenesis in maize. EMBO J.. 36: 707-717.
  • Grove MD, Spencer GF, Rohwedder WK, Mandava N, Worley JF, David Warthen J, et al. 1979. Brassinolide, a plant growth-promoting steroid isolated from Brassica napus pollen. Nature. 281(5728): 216-217.
  • Gui CP, Dong X, Liu HK, Huang WJ, Zhang D, Wang SJ, et al. 2014. Overexpression of the tomato pollen receptor kinase LePRK1 rewires pollen tube growth to a blebbing mode. Plant Cell. 26: 3538-3555.
  • Higashiyama T, Hamamura Y. 2008. Gametophytic pollen tube guidanc. Sex. Plant Reprod.. 21: 17-26.
  • Higashiyama T, Yabe S, Sasaki N, Nishimura Y, Miyagishima S, Kuroiwa H, et al. 2001. Pollen tube attraction by the synergid cell. Science. 293: 1480-1483.
  • Higashiyama T. 2010. Peptide signaling in pollen-pistil interactions. Plant Cell Physiol.. 51: 177-189.
  • Holk A, Rietz S, Zahn M, Quader H, Scherer GF. 2002. Molecular identification of cytosolic, patatin related phospholipases A from Arabidopsis with potential functions in plant signal transduction. Plant Physiol.. 130: 90-101.
  • Iwata E, Ikeda S, Matsunaga S, Kurata M, Yoshioka Y, Criqui MC, et al. 2011. GIGAS CELL1, a novel negative regulator of the anaphase-promoting complex/cyclosome, is required for proper mitotic progression and cell fate determination in Arabidopsis. Plant cell. 23: 4382-4393.
  • Kelliher T, Starr D, Richbourg L, Chintamanani S, Delzer B, Nuccio ML, et al. 2017. MATRILINEAL, a sperm-specific phospholipase, triggers maize haploid induction. Nature. 542: 105-109.
  • Kost B, Lemichez E, Spielhofer P, Hong Y, Tolias K, Carpenter C, et al. 1999. Rac homologues and compartmentalized phosphatidylinositol 4,5-bisphosphate act in a common pathway to regulate polar pollen tube growth. J. Cell Biol.. 145: 317-330.
  • Kuppu S, Ron M, Marimuthu MPA, Li G, Huddleson A, Siddeek MH, et al. 2020. A variety of changes, including CRISPR/Cas9-mediated deletions, in CENH3 lead to haploid induction on outcrossing. Plant Biotechnol. J.. 18(10): 2068-2080.
  • Kwak JS, Kwon DH, Song JT, Seo HS. 2021. A mutation in the pPLA-IIa gene encoding PATATIN-RELATED PHOSPHOLIPASE A causes late flowering in Arabidopsis. Biochem. Biophys. Res. Commun.. 582: 16-20.
  • Labusch C, Shishova M, Effendi Y, Li M, Wang X, Scherer GFE. 2013. Patterns and timing in expression of early auxin-induced genes imply involvement of phospho-lipases A (pPLAs) in the regulation of auxin responses. Mol. Plant. 6: 1473-1486.
  • Lee HS, Karunanandaa B, McCubbin A, Gilroy S, Kao TH. 1996. PRK1, a receptor-like kinase of Petunia inflata, is essential for postmeiotic development of pollen. Plant J.. 9: 613-624.
  • Li H, Lin Y, Heath RM, Zhu MX, Yang Z. 1999. Control of pollen tube tip growth by a Rop GTPase-dependent pathway that leads to tip-localized calcium influx. Plant Cell. 11: 1731-1742.
  • Li M, Bahn SC, Fan C, Li J, Phan T, Oritiz M, et al. 2013. Patatin-related phospholipase pPLAIII delta increases seed oil content with long-chain fatty acids in Arabidopsis. Plant Physiol.. 162: 39-51.
  • Liang Y, Tan ZM, Zhu L, Niu QK, Zhou JJ, Li M, et al. 2013. MYB97, MYB101 and MYB120 function as male factors that control pollen tube-synergid interaction in Arabidopsis thaliana fertilization. PLoS Genet.. 9(11): e1003933
  • Liu C, Li X, Meng D, Zhong Y, Chen C, Dong X, et al. 2017. A 4- bp insertion at ZmPLA1 encoding a putative phospholipase A generates haploid induction in maize. Mol. Plant. 10: 520-522.
  • Liu J, Zhong S, Guo X, Hao L, Wei X, Huang Q. 2013. Membrane-bound RLCKs LIP1 and LIP2 are essential male factors controlling male-female attraction in Arabidopsis. Curr. Biol.. 23(11): 993-998.
  • McConn M, Browse J. 1996. The critical requirement for linolenic acid is pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell. 8: 403-416.
  • Mecchia MA, Santos-Fernandez G, Duss NN, Somoza SC, Boisson-Dernier A, Gagliardini V, et al. 2017. RALF4/19 peptides interact with LRX proteins to control pollen tube growth in Arabidopsis. Science. 358(6370): 1600-1603.
  • Meijer HJG, Munnik T. 2003. Phospholipid-based signaling in plants. Annu. Rev. Plant Biol.. 54: 265-306.
  • Miyazaki S, Murata T, Sakurai-Ozato N, Kubo M, Demura T, Fukuda H, et al. 2009. ANXUR1 and 2, sister genes to FERONIA/SIRENE, are male factors for coordinated fertilization. Curr. Biol.. 19: 1327-1331.
  • Cesiliato PH, Ribeiro B, Ortiz Morea FA, Franco Garcia AA, Silva-Filho MC, et al. Morato do Canto A2014. Biological activity of nine recombinant AtRALF peptides: implications for their perception and function in Arabidopsis. Plant Physiol. Biochem.. 75: 45-54.
  • Mori T, Igawa T, Tamiya G, Miyagishima SY, Berger F. 2014. Gamete attachment requires GEX2 for successful fertilization in Arabidopsis. Curr. Biol.. 24: 170-175.
  • Muschietti J, Eyal Y, McCormick S. 1998. Pollen tube localization implies a role in pollen-pistil interactions for the tomato receptor-like protein kinases LePRK1 and LePRK2. Plant Cell. 10: 319-330.
  • Ogura Y, Shibata F, Sato H, Murata M. 2004. Characteri-zation of a CENP-C homolog in Arabidopsis thaliana. Genes Genet. Syst.. 79: 139-144.
  • Okuda S, Tsutsui H, Shiina K, Sprunck S, Takeuchi H, Yui R, et al. 2009. Defensin-like polypeptide LUREs are pollen tube attractants secreted from synergid cells. Nature. 458: 357-361.
  • Park BS, Song JT, Seo HS. 2011. Arabidopsis nitrate reductase activity is stimulated by the E3 SUMO ligase AtSIZ1. Nat. Commun.. 2: 400
  • Punwani JA, Drews GN. 2008. Development and function of the synergid cell. Sex. Plant Reprod.. 21: 7-15.
  • Ravi M, Chan SWL. 2010. Haploid plants produced by centromere-mediated genome elimination. Nature. 46: 615-618.
  • Ravi M, Kwong PN, Menorca RMG, Valencia JT, Ramahi JS, Stewart JL, et al. 2010. The rapidly evolving centromere- specific histone has stringent functional requirements in Arabidopsis thaliana. Genetics. 186: 461-471.
  • Rietz S, Dermendjiev G, Oppermann E, Tafesse FG, Effendi Y, Holk A, et al. 2010. Roles of Arabidopsis patatin-related phospholipases A in root development are related to auxin responses and phosphate deficiency. Mol. Plant. 3: 524-538.
  • Rotman N, Durbarry A, Wardle A, Yang WC, Chaboud A, Faure JE, et al. 2005. A novel class of MYB factors controls sperm cell formation in plants. Curr. Biol.. 15: 244-248.
  • Rydel TJ, Williams JM, Krieger E, Moshiri F, Stallings WC, Brown SM, et al. 2003. The crystal structure, mutagenesis, and activity studies re-veal that patatin is a lipid acyl hydrolase with a Ser-Asp catalytic dyad. Biochemistry. 42: 6696-6708.
  • Ryu SB. 2004. Phospholipid-derived signaling mediated by phospholipase A in plants. Trends Plant Sci.. 9: 229-235.
  • Salem T, Mazzella A, Barberini ML, Wengier D, Motillo V, Parisi G, et al. 2011. Mutations in two putative phosphorylation motifs in the tomato pollen receptor kinase LePRK2 show antagonistic effects on pollen tube length. J Biol. Chem.. 286: 4882-4891.
  • Scherer GF, Pietrzyk P. 2014. Gravity-dependent differen-tiation and root coils in Arabidopsis thaliana wild type and phospholipase-A-I knockdown mutant grown on the International Space Station. Plant Biol. 16(Suppl 1). 1: 97-106.
  • Scherer GF, Ryu SB, Wang X, Matos AR, Heitz T. 2010. Patatin-related phospholipaseA: nomenclature, subfamilies and functions in plants. Trends Plant Sci. 15: 693-700.
  • Scherer GF. 1996. Phospholipid signalling and lipid-derived second messengers in plants. Plant Growth Regul.. 18: 125-133.
  • Schiøtt M, Romanowsky SM, Baekgaard L, Jakobsen MK, Palmgren MG, Harper JF. 2004. A plant plasma membrane Ca2＋ pump is required for normal pollen tube growth and fertilization. Proc. Natl. Acad. Sci. USA.. 101(25): 9502-9527.
  • Sede AR, Borassi C, Wengier DL, Mecchia MA, Estevez JM, Muschietti JP. 2018. Arabidopsis pollen extensins LRX are required for cell wall integrity during pollen tube growth. FEBS Lett.. 592(2): 233-243.
  • Senda K, Yoshioka H, Doke N, Kawakita K. 1996. A cytosolic phospholipase A2 from potato tissues appears to be patatin. Plant Cell Physiol.. 37: 347-353.
  • Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al. 2010. Jasmonate perception by inositol- phosphate-potentiated COI1-JAZ co-receptor. Nature. 468: 400-405.
  • Shewry PR. 2003. Tuber storage proteins. Ann. Bot.. 91: 755-769.
  • Shimizu T, Ohto T, Kita Y. 2006. Cytosolic phospholipaseA2: Biochemical properties and physiological roles. IUBMB. Life. 58: 328-333.
  • Shono N, Ohzeki J, Otake K, Martins NM, Nagase T, Kimura H, et al. 2015. CENP-C and CENP-I are key connecting factors for kinetochore and CENP-A assembly. J. Cell Sci.. 128: 4572-4587.
  • Singh DK, Andreuzza S, Panoli AP, Siddiqi I. 2013. AtCTF7 is required for establishment of sister chromatid cohesion and association of cohesin with chromatin during meiosis in Arabidopsis. BMC Plant Biol.. 13: 117
  • Six DA, Dennis EA. 2000. The expanding superfamily of phospholipase A 2 enzymes: classification and charac-terization. Biochim. Biophys. Acta-Mol. Cell Biol. Lipid. 1488: 1-19.
  • Takeuchi H, Higashiyama T. 2012. A species-specific cluster of defensin-like genes encodes diffusible pollen tube attractants in Arabidopsis. PLoS Biol.. 10: e1001449
  • Takeuchi H, Higashiyama T. 2016. Tip-localized receptors control pollen tube growth and LURE sensing in Arabidopsis. Nature. 531: 245-248.
  • Wang T, Liang L, Xue Y, Jia PF, Chen W, Zhang MX, et al. 2016. A receptor heteromer mediates the male perception of female attractants in plants. Nature. 531: 241-244.
  • Wilhelmi LK, Preuss D. 1997. Blazing new trails (Pollen tube guidance in flowering plants). Plant Physiol.. 113: 307-312.
  • Xie DX, Feys B, James S, Nieto-Rostro M, Turner J. 1998. COI1: An Arabidopsis gene required for jasmonate- regulated defense and fertility. Science. 280: 1091-1094.
  • Yang W, Devaiah SP, Pan X, Isaac G, Welti R, Wang X. 2007. AtPLAI is an acyl hydrolase involved in basal jasmonic acid production and Arabidopsis resistance to Botrytis cinerea. J. Biol. Chem.. 282: 18116-18128.
  • Yang WY, Zheng Y, Bahn SC, Pan XQ, Li MY, Vu HS, et al. 2012. The patatin-containing phospholipase ApPLAIIa modulates oxylipin formation and water loss in Arabidopsis thaliana. Mol. Plant. 5: 452-460.
  • Yao L, Zhang Y, Liu C, Liu Y, Wang Y, Liang D, et al. 2018. OsMATL mutation induces haploid seed formation in indica rice. Nat. Plants. 4: 530-533.
  • Ye Q, Zhu W, Li L, Zhang S, Yin Y, Ma H, Wang X. 2010. Brassinosteroids control male fertility by regulating the expression of key genes involved in Arabidopsis anther and pollen development. Proc. Natl. Acad. Sci. USA. 107 (13): 6100-6105..
  • Zhang D, Wengier D, Shuai B, Gui CP, Muschietti J, McCormick S, et al. 2008. The pollen receptor kinase LePRK2 mediates growth-promoting signals and positively regulates pollen germination and tube growth. Plant Physiol.. 148: 1368-1379.
  • Zhou J, Rumeau D, Showalter AM. 1992. Isolation and characterization of two wound-regulated tomato extensin genes. Plant Mol. Biol.. 20: 5-17.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Loss of Arabidopsis PATATIN-RELATED PHOSPHOLIPASE 2A Affects the Expression of Genes Involved in Fertilization
Plant Breed. Biotech.. 2022;10(1):49-61.   Published online March 28, 2022
DOI: https://doi.org/10.9787/PBB.2022.10.1.49
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.
Format:
Include:
Loss of Arabidopsis PATATIN-RELATED PHOSPHOLIPASE 2A Affects the Expression of Genes Involved in Fertilization
Plant Breed. Biotech.. 2022;10(1):49-61.   Published online March 28, 2022
DOI: https://doi.org/10.9787/PBB.2022.10.1.49
Close

Figure

  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
Loss of Arabidopsis PATATIN-RELATED PHOSPHOLIPASE 2A Affects the Expression of Genes Involved in Fertilization
Image Image Image Image Image Image Image
Fig. 1 Phenotypes of WT and ppla-iia mutant plants. Seeds of WT and ppla-iia mutants were germinated on MS media or in the soil and then photographed at germination, vegetative growth and flowering stages.
Fig. 2 Evaluation of the effect of pPLA-IIa on the expression of pollen tube growth-regulating genes. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of AtRALF4, AUN1, LRX10, AtMYB97, and ROP1 were analyzed by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
Fig. 3 Analysis of the effect of pPLA-IIa on the expression of genes encoding pollen receptors. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of LIP1, LIP2, ANX1, ANX2, PRK1, and MDIS1 were analyzed by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
Fig. 4 Examination of the effect of pPLA-IIa on the expression of the AtLURE1.1 gene, which encodes a synergid-secreted protein. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and the expression level of AtLURE1.1 was examined by real-time qRT-PCR using gene- specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
Fig. 5 Examination of the effect of pPLA-IIa on the expression of cell division-related genes. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of CENH3, CENPC, CTF7, and DUO1 were examined by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (*P < 0.1, **P < 0.01, ***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
Fig. 6 Analysis of the effect of pPLA-IIa on the expression of ACA9, which encodes a Ca2＋ pump. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and the expression level of ACA9 was examined by real-time qRT-PCR using-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.
Fig. 7 Evaluation of the effect of pPLA-IIa on the expression of hormone-related genes. Total RNA was isolated from the flowers of WT and ppla-iia mutant plants, and expression levels of COI1 and BRI1 were examined by real-time qRT-PCR using gene-specific primers. Data shown are means ± SE from three biological replications and three technical repeats in each. Asterisks indicate statistically significant differences in grain weight (**P < 0.01, ***P < 0.001; Student’s t-test) between WT and ppla-iia mutant plants.

Fig. 1

Fig. 2

Fig. 3

Fig. 4

Fig. 5

Fig. 6

Fig. 7

Loss of Arabidopsis PATATIN-RELATED PHOSPHOLIPASE 2A Affects the Expression of Genes Involved in Fertilization

List of primers used in this study.

Category Gene Forward primer Reverse primer PCR product (bp)
Ion pump ACA9 5’-GCAGGCTTAAGCATTCTTGG-3’ 5’-TTCTTGCGTTGAACTCGTTG-3’ 120
Receptor LIP1 5’-TGAAACAAACGCAACTGCTC-3’ 5’-CGTGATCTCTACCGCTGTCA-3’ 149
LIP2 5’-GAGCTTATCACGGGTCGAAG-3’ 5’-GATGCTTCCTCTTGCACACA-3’ 200
ANX1 5’-GAGGCGACTCTCACACATCA-3’ 5’-CAATGACGTTGGAATCATCG-3’ 192
ANX2 5’-GCAGGCTTAAGCATTCTTGG-3’ 5’-GCAGGCTTAAGCATTCTTGG-3’ 146
MDIS1 5’-ATGGGCGTCAAAGTATCTGG-3’ 5’-GGTCTTTGGCTTTCGTCAAG-3’ 138
PRK1 5’-GGATTTAGCGAGTTGGGTGA-3’ 5’-TCTTCTCCACAGCCTGTCCT-3’ 182
Attractant LURE1.1 5’-CCTTTCGATCCACGTTCACT-3’ 5’-GCAACGACAAAGTTTTCTTTCAA-3’ 135
RALF4 5’-CATTGGCTACGATGCTCTCA-3’ 5’-CATCCACGCCTGTAAGGATT-3’ 108
CLE45 5’-ACGCGTTCTCGAGGAAGTTA-3’ 5’-GGCTGAGCTTTGTTGTGGAT-3’ 141
Activator AUN1 5’-GAGGCCATCAGGTAGTGGAA-3’ 5’-ACCGGCATTGTCAAACTCTC-3’ 104
LRX10 5’-CGGACAAGGTGATTCATGTG-3’ 5’-ACTGGACGGCTAATCACCAC-3’ 129
MYB97 5’-GCTTCTTGACTGGGGAAGTG-3’ 5’-TGGCAAGTTGTTGGTGTCAT-3’ 139
ROP1 5’-TTCAGTGCCAATGTTGTGGT-3’ 5’-TGCTCCACGGTAACTCAGTG-3’ 108
Meiosis gene DUO1 5’-TGGTTTGGTTGAGGAAGAGG-3’ 5’-AGCGAAAGGCTGATGCTCTA-3’ 133
CENH3 5’-AGAGATTCGCCATTTCCAGA-3’ 5’-AGCTTCAGCTGTCCAACGAT-3’ 124
CENPC 5’-TCTTACGCATGAGGGGAAAC-3’ 5’-TCGAGCGGTCTCGACTTAAT-3’ 111
CTF7 5’-TTTTAAGGGTTGGCAGAACG-3’ 5’- GTTTCTGTGTGCAGGGGAAT -3’ 100
OSD1 5’-TGGCCGAGTTATTGAGATCC-3’ 5’-GCTTGAATCCCACAGATGGT-3’ 119
Hormone related gene COI1 5’-CTTCCGCCTTGTCTTACTCG-3’ 5’-GTTAAGCCGCCTTGTCTCAG-3’ 132
BRI1 5’-ACGAGCGGCTTCTTGTGTAT-3’ 5’-GCCGTGTGGACCAGTTTAGT-3’ 102
Table 1 List of primers used in this study.

Table 1

ABOUT

BROWSE ARTICLES

EDITORIAL POLICIES

FOR CONTRIBUTORS

© The Korean Society of Breeding Science.