Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Inheritance and Quantitative Trait Loci Analysis of Resistance Genes to Bruchid and Bean Bug in Mungbean (Vigna radiata L. Wilczek)

Plant Breeding and Biotechnology 2015;3(1):39-46.
Published online: March 31, 2015

1Animal and Plant Quarantine Agency, Anyang, 380-757, Rep. of Korea

2National Institute of Crop Science, RDA, Suwon, 441-857, Rep. of Korea

3National Institute of Crop Science, RDA, Pyeongchang, 232-955, Rep. of Korea

4Rural Development Administration, Jeonju, 560-500, Rep. of Korea

5Shingyeong University, Hwasung, 445-741, Republic of Korea

6National Institute of Crop Science, RDA, Wanju, 565-238, Rep. of Korea

*Corresponding author: Jung-Kyung Moon, moonjk2@korea.kr, Tel: +82-63-238-5321, Fax: +82-63-238-5305

These authors contributed equally to this work.

• Received: March 26, 2015   • Revised: March 29, 2015   • Accepted: March 29, 2015

Copyright © 2015 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 15 Views
  • 0 Download
  • 20 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Induction of Plant Defences and Production of Kaempferol‐7‐O‐Glucoside Against Spodoptera litura in Resistant Wild Mungbean
    Sook‐Kuan Lee, Bing‐Rong Chen, Chih‐Yu Lin, Cheng‐Hsiang Kuo, Yi‐Ju Chen, Ya‐Ping Lin, Yuan‐Yun Zhang, Ripley H. Tisdale, Cheng‐Ruei Lee, Wen‐Po Chuang, Hieng‐Ming Ting
    Plant, Cell & Environment.2026; 49(7): 4558.     CrossRef
  • Metabolic Discrimination of Mungbean (Vigna radiata L.) Sprout Depending on Growth Time from Multivariate Analysis of FT-IR Spectroscopy Data
    Song Yie Park, Yeong Jae Ah, Eun Ji Suh, Eun Bin Choi, Mi Ja Lee, Han Gyeol Lee, Woo Duck Seo, Yu-Na Kim, Seung-Yeob Song
    Korean Journal of Breeding Science.2024; 56(3): 269.     CrossRef
  • Genome-Wide Association Studies on Resistance to Pea Weevil: Identification of Novel Sources of Resistance and Associated Markers
    Salvador Osuna-Caballero, María J. Cobos, Carmen M. Ruiz, Osman Z. Wohor, Nicolas Rispail, Diego Rubiales
    International Journal of Molecular Sciences.2024; 25(14): 7920.     CrossRef
  • Next-Generation Sequencing in the Development of Climate-Resilient and Stress-Responsive Crops – A Review
    Amitava Roy, Suman Dutta, Sumanta Das, Malini Roy Choudhury
    The Open Biotechnology Journal.2024;[Epub]     CrossRef
  • Molecular mechanisms, genetic mapping, and genome editing for insect pest resistance in field crops
    Shabir H. Wani, Mukesh Choudhary, Rutwik Barmukh, Pravin K. Bagaria, Kajal Samantara, Ali Razzaq, Jagdish Jaba, Malick Niango Ba, Rajeev K. Varshney
    Theoretical and Applied Genetics.2022; 135(11): 3875.     CrossRef
  • Thirty Years of Mungbean Genome Research: Where Do We Stand and What Have We Learned?
    Prakit Somta, Kularb Laosatit, Xingxing Yuan, Xin Chen
    Frontiers in Plant Science.2022;[Epub]     CrossRef
  • Screening of endemic wild Vigna accessions for resistance to three bruchid species
    Revanasidda Aidbhavi, Aditya Pratap, Prasoon Verma, Amrit Lamichaney, Sanjay M. Bandi, S.D. Nitesh, Mohd Akram, Meenal Rathore, Bansa Singh, Narendra P. Singh
    Journal of Stored Products Research.2021; 93: 101864.     CrossRef
  • Two polygalacturonase-inhibiting proteins (VrPGIP) of Vigna radiata confer resistance to bruchids (Callosobruchus spp.)
    Qinxue Zhang, Qiang Yan, Xingxing Yuan, Yun Lin, Jingbin Chen, Ranran Wu, Chenchen Xue, Yuelin Zhu, Xin Chen
    Journal of Plant Physiology.2021; 258-259: 153376.     CrossRef
  • Biotic and Abiotic Constraints in Mungbean Production—Progress in Genetic Improvement
    Ramakrishnan M. Nair, Abhay K. Pandey, Abdul R. War, Bindumadhava Hanumantharao, Tun Shwe, AKMM Alam, Aditya Pratap, Shahid R. Malik, Rael Karimi, Emmanuel K. Mbeyagala, Colin A. Douglas, Jagadish Rane, Roland Schafleitner
    Frontiers in Plant Science.2019;[Epub]     CrossRef
  • Effects of radiofrequency on the development and performance of Callosobruchus chinensis (Coleoptera: Chrysomelidae: Bruchinae) on three different leguminous seeds
    Rameswor Maharjan, Hwijong Yi, Jeongjoon Ahn, Gwang Hyun Roh, Chunggyoo Park, Youngnam Yoon, Yunwoo Jang, Inyoul Baek, Yongchul Kim, Soondo Bae
    Applied Entomology and Zoology.2019; 54(3): 255.     CrossRef
  • Mung bean (Vigna radiata) cultivars mediated oviposition preference and development of Callosobruchus chinensis (Coleoptera: Chrysomelidae: Bruchinae)
    Rameswor Maharjan, Hwijong Yi, Hyuntae Kim, Youngnam Yoon, Yunwoo Jang, Soondo Bae
    Applied Entomology and Zoology.2018; 53(1): 55.     CrossRef
  • Bruchid pest management in pulses: past practices, present status and use of modern breeding tools for development of resistant varieties
    S.K. Mishra, M.L.R. Macedo, S.K. Panda, J. Panigrahi
    Annals of Applied Biology.2018; 172(1): 4.     CrossRef
  • Beans with Benefits—The Role of Mungbean (<i>Vigna radiate</i>) in a Changing Environment
    Lisa Pataczek, Zahir Ahmad Zahir, Maqshoof Ahmad, Saima Rani, Ramakrishnan Nair, Roland Schafleitner, Georg Cadisch, Thomas Hilger
    American Journal of Plant Sciences.2018; 09(07): 1577.     CrossRef
  • Novel Alleles of Two Tightly Linked Genes Encoding Polygalacturonase-Inhibiting Proteins (VrPGIP1 and VrPGIP2) Associated with the Br Locus That Confer Bruchid (Callosobruchus spp.) Resistance to Mungbean (Vigna radiata) Accession V2709
    Anochar Kaewwongwal, Jingbin Chen, Prakit Somta, Alisa Kongjaimun, Tarika Yimram, Xin Chen, Peerasak Srinives
    Frontiers in Plant Science.2017;[Epub]     CrossRef
  • Chilling susceptibility in mungbean varieties is associated with their differentially expressed genes
    Li-Ru Chen, Chia-Yun Ko, William R. Folk, Tsai-Yun Lin
    Botanical Studies.2017;[Epub]     CrossRef
  • Mechanism of Resistance in Mungbean [Vigna radiata (L.) R. Wilczek var. radiata] to bruchids, Callosobruchus spp. (Coleoptera: Bruchidae)
    Abdul R. War, Surya Murugesan, Venkata N. Boddepalli, Ramasamy Srinivasan, Ramakrishnan M. Nair
    Frontiers in Plant Science.2017;[Epub]     CrossRef
  • Identification of single nucleotide polymorphism markers associated with resistance to bruchids (Callosobruchus spp.) in wild mungbean (Vigna radiata var. sublobata) and cultivated V. radiata through genotyping by sequencing and quantitative trait locus a
    Roland Schafleitner, Shu-mei Huang, Shui-hui Chu, Jo-yi Yen, Chen-yu Lin, Miao-rong Yan, Bharath Krishnan, Mao-sen Liu, Hsiao-feng Lo, Chien-yu Chen, Long-fang O. Chen, Dung-chi Wu, Thu-Giang Thi Bui, Srinivasan Ramasamy, Chih-wei Tung, Ramakrishnan Nair
    BMC Plant Biology.2016;[Epub]     CrossRef
  • Construction of an integrated map and location of a bruchid resistance gene in mung bean
    Lixia Wang, Chuanshu Wu, Min Zhong, Dan Zhao, Li Mei, Honglin Chen, Suhua Wang, Chunji Liu, Xuzhen Cheng
    The Crop Journal.2016; 4(5): 360.     CrossRef
  • Genomic and transcriptomic comparison of nucleotide variations for insights into bruchid resistance of mungbean (Vigna radiata [L.] R. Wilczek)
    Mao-Sen Liu, Tony Chien-Yen Kuo, Chia-Yun Ko, Dung-Chi Wu, Kuan-Yi Li, Wu-Jui Lin, Ching-Ping Lin, Yen-Wei Wang, Roland Schafleitner, Hsiao-Feng Lo, Chien-Yu Chen, Long-Fang O. Chen
    BMC Plant Biology.2016;[Epub]     CrossRef
  • A gene encoding a polygalacturonase-inhibiting protein (PGIP) is a candidate gene for bruchid (Coleoptera: bruchidae) resistance in mungbean (Vigna radiata)
    Sathaporn Chotechung, Prakit Somta, Jinbing Chen, Tarika Yimram, Xin Chen, Peerasak Srinives
    Theoretical and Applied Genetics.2016; 129(9): 1673.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Inheritance and Quantitative Trait Loci Analysis of Resistance Genes to Bruchid and Bean Bug in Mungbean (Vigna radiata L. Wilczek)
Plant Breed. Biotech.. 2015;3(1):39-46.   Published online March 31, 2015
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Inheritance and Quantitative Trait Loci Analysis of Resistance Genes to Bruchid and Bean Bug in Mungbean (Vigna radiata L. Wilczek)
Plant Breed. Biotech.. 2015;3(1):39-46.   Published online March 31, 2015
Close

Figure

  • 0
  • 1
  • 2
Inheritance and Quantitative Trait Loci Analysis of Resistance Genes to Bruchid and Bean Bug in Mungbean (Vigna radiata L. Wilczek)
Image Image Image
Fig. 1 Bulked segregant analysis for bruchid and bean bug resistance using random decamers: (a) BEXA99, (b) OPU11, (c) OPB10, (d) OPU06. M: molecular weight marker; Lane 1: Jangan mungbean (resistant parent), Land 2: Sunhwa mungbean (susceptible parent), Lane 3: resistant bulk, Lane 4: susceptible bulk, Lane 5: Keumsung mungbean (susceptible check), Lane 6: TC1966 (resistant check). Arrow indicates polymorphic band between resistant and susceptible bulk.
Fig. 2 CAP analysis for bruchid and bean bug resistance genes using BEXA99 for/rev primers followed by Mse I enzyme digestion. Three bands (two from susceptible parent and one from resistant parent) revealed allelic polymorphism between the parents and F2 individuals. S: susceptible parent, Sunhwa mungbean; R: resistant parent, Jangan mungbean; M: molecular weight marker. Arrows indicate polymorphic bands for susceptible and resistant parents, respectively.
Fig. 3 QTL map for chromosome segment associated with insect resistance using composite interval mapping. Markers are indicated under the X axis with intervals. Additive effects of each QTL were depicted over the X axis of the QTL map.
Inheritance and Quantitative Trait Loci Analysis of Resistance Genes to Bruchid and Bean Bug in Mungbean (Vigna radiata L. Wilczek)

Primer list of SSR, STS, RAPD, and CAPs markers used in this study.

Marker Primer sequence (5′ to 3′) Expected Size (bp)
MB87 Forward TCCCTTGTGGGAGATCCT 293
Reverse CTTTGCCACACTCCTTGC
RP Forward ATGGAGTTTCAGTGCCTTGC 896 – 1391
Reverse CACACAATCCAGAAATGCCTTA
BAXA99 - AGGGTGCGTATA
OPB10 - CTGCTGGGAC
OPU06 - ACCTTTGCGG
OPU11 - AGACCCAGAG
CBAXA99 Forward GCGGTCAGCACAGAATTTACTCATTT 920
Reverse CAGCACACTAACGATACATTTGACACG
COPU11 Forward ACCCAGAGTCAAAGAGCAGTAACACC 781
Reverse GACCCAGAGCAAGGCGAAGA
COPU06 Forward CCTTTGCGGCATTTTGAAGGT 542
Reverse TGCGGTTCCTATCAGCGTTCA
COPB10 Forward CTGGGACGTAAGCTATGGTGCAG 970
Reverse GCTGGGACCAAGGACCACAA

Segregation ratio of F1, F2, and F2:3 seeds derived from two combinations of crosses with Sunhwa mungbean, Jangan mungbean, and TC1966.

Pest Crosses F1 seeds F2 seeds

Hy) Dy) H D χ2 (3:1) P Cross test

H D
Bruchid Sz) × Jz) 14 0 123 35 0.68 0.41 124 10
Tz) × J 5 0 960 38 239.05 NS 950 38

Bean bug S × J 14 0 134 36 0.65 0.25 119 4
T × J 5 0 988 8 311.01 NS 952 8

z)S indicates Sunhwa mungbean; J is for Jangan mungbean; T refers to TC1966.

y)H and D indicate healthy and damaged phenotypes infested with insect, respectively.

QTLs association with resistance to bruchid and bean bug, determined using one-way ANOVA, multiple regression (MLG-Regr.), and composite interval mapping (CIM).

Insect Locus Map position (cM) Single factor ANOVA MLG-Regr. CIM

P R2 Allelic means P R2 LOD R2

S H J
Bruchid MB87 0 5.77E-71 0.58 76.8 27.1 4.1 77.8 0.45
COPU11 6.7 8.03E-98 0.69 80.7 25.6 2.4
CBAXA99 8.2 2.02E-117 0.76 81.8 24.4 1.4
RP 9.0 7.35E-128 0.79 81.7 23.4 1.4 <.0001 0.72 86.2 0.46
COPU06 11.4 1.11E-98 0.70 80.2 26.3 2.1
COPB10 13.7 1.50E-88 0.66 78.8 25.7 3.3

Bean bug MB87 0 3.22E-68 0.56 54.2 18.9 3.0
COPU11 6.7 5.70E-88 0.66 56.3 18.0 2.0
CBAXA99 8.2 1.92E-98 0.70 56.6 17.4 1.5
RP 9.0 6.18E-108 0.73 56.7 16.6 1.5 <.0001 0.67 76.5 0.42
COPU06 11.4 1.25E-90 0.67 56.3 18.2 1.9
COPB10 13.7 4.74E-84 0.64 55.7 17.6 2.9
Table 1 Primer list of SSR, STS, RAPD, and CAPs markers used in this study.
Table 2 Segregation ratio of F1, F2, and F2:3 seeds derived from two combinations of crosses with Sunhwa mungbean, Jangan mungbean, and TC1966.

S indicates Sunhwa mungbean; J is for Jangan mungbean; T refers to TC1966.

H and D indicate healthy and damaged phenotypes infested with insect, respectively.

Table 3 QTLs association with resistance to bruchid and bean bug, determined using one-way ANOVA, multiple regression (MLG-Regr.), and composite interval mapping (CIM).