Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Screening of Cabbage (Brassica oleracea L.) Germplasm for Resistance to Black Rot

Plant Breeding and Biotechnology 2018;6(1):30-43.
Published online: March 1, 2018

1Department of Horticulture, Sunchon National University, Suncheon 57922, Korea

2Department of Genetics and Plant Breeding, Sher-e-Bangla Agricultural University, Dhaka-1207, Bangladesh

*Corresponding author: Ill-Sup Nou, nis@sunchon.ac.kr, Tel: +82-61-750-3249, Fax: +82-61-750-3208
• Received: January 20, 2018   • Revised: January 31, 2018   • Accepted: January 31, 2018

Copyright © 2018 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 454 Views
  • 7 Download
  • 24 Crossref
prev next

Citations

Citations to this article as recorded by  Crossref logo
  • Integrating Hybrid and Molecular Breeding as Approaches in Vegetable Breeding Strategies
    Janko Červenski, Srđan Zec, Gordana Tamindžić, Dragana Miljaković, Jelena Marinković, Boris Adamović, Đorđe Vojnović, Aleksandra Ilić
    Horticulturae.2026; 12(6): 666.     CrossRef
  • Black rot of crucifers: recent advances and future perspectives
    Dinesh Singh
    Indian Phytopathology.2026; 79(1): 13.     CrossRef
  • Complete genome sequence of Xanthomonas campestris pv. campestris strain NSTU_AG-1 causing black rot disease isolated from infected cabbage leaves in Bangladesh
    Arnab Goswami, Maksudur R. Nayem, Pijush K. Jhan, Amena Khatun, A.B.Z. N. Rahman, Mahmudul Hasan, Swagato Dutta, Md T. Islam, Jong-In Park, Mehede H. Rubel, Leighton Pritchard
    Microbiology Resource Announcements.2026;[Epub]     CrossRef
  • Race-specific resistance in Brassica oleracea cultivars against Xanthomonas campestris pv. campestris: insights from Turkish isolates
    Songül Erken Meral, Hasan Murat Aksoy, Hayati Kar
    Journal of Plant Diseases and Protection.2026;[Epub]     CrossRef
  • Morpho-Molecular Identification and Race Detection of Xanthomonas campestris pv. campestris Causing Black Rot Disease of Cabbage in Bangladesh
    Arnab Goswami, Nafisa Akter Sadia, Pijush Kanti Jhan, Mahmudul Hasan, Tofazzal Islam, Ujjal Kumar Nath, Jong-In Park, Mehede Hassan Rubel
    Australasian Plant Pathology.2026;[Epub]     CrossRef
  • Constructing a Novel Disease Resistance Mechanism Model for Cruciferous Crops: An Example From Black Rot
    Haojie Dai, Linli Hu, Jie Wang, Zhibin Yue, Jue Wang, Tongyan Chen, Jinbao Li, Tingting Dou, Jihua Yu, Zeci Liu
    Molecular Plant Pathology.2025;[Epub]     CrossRef
  • Molecular marker development for specific amplification of Xanthomonas campestris pv. campestris race 8 causing black rot disease in Brassica crops
    Sopheap Mao, Yeo-Hyeon Kim, Nihar Sahu, Su-Won Kim, Hoy-Taek Kim, Masao Watanabe, Jong-In Park
    Journal of General Plant Pathology.2025; 91(1): 31.     CrossRef
  • The Current Status and Prospects of Molecular Marker Applications in Head Cabbage (Brassica oleracea var. capitata L.): A Review
    Ilya V. Strembovskiy, Pavel Yu. Kroupin
    Agronomy.2025; 15(11): 2644.     CrossRef
  • Genetic and Epigenetic Mechanisms Underpinning Biotic Stress Resilience of Brassica Vegetables
    Mst. Arjina Akter, Mei Iwamura, Shrawan Singh, Md Asad-Ud Doullah, Ryo Fujimoto, Henrik U. Stotz, Hasan Mehraj
    Plants.2025; 14(24): 3765.     CrossRef
  • Marker-assisted selection and DH-technology utilized to accelerate fusarium-resistant cabbage (Brassica oleracea var. capitata L.) line development
    M. G. Fomicheva, G. A. Kostenko, A. S. Domblides
    Vegetable crops of Russia.2024; (6): 5.     CrossRef
  • Study of cabbage antioxidant system response on early infection stage of Xanthomonas campestris pv. campestris
    Zeci Liu, Jie Wang, Zhibin Yue, Jue Wang, Tingting Dou, Tongyan Chen, Jinbao Li, Haojie Dai, Jihua Yu
    BMC Plant Biology.2024;[Epub]     CrossRef
  • Field Evaluations of Plant Defense Activators and Sulfur as Alternatives to Copper Bactericides for the Management of Cabbage Black Rot in Florida
    Roger R. Ramirez, Nicholas S. Dufault, Mathews L. Paret, Gary E. Vallad
    Plant Health Progress.2024; 25(4): 438.     CrossRef
  • A GBS-based genetic linkage map and quantitative trait loci (QTL) associated with resistance to Xanthomonas campestris pv. campestris race 1 identified in Brassica oleracea
    Lu Lu, Su Ryun Choi, Yong Pyo Lim, Si-Yong Kang, So Young Yi
    Frontiers in Plant Science.2023;[Epub]     CrossRef
  • Comparative Genomic Analysis of Xanthomonas campestris pv. campestris Isolates BJSJQ20200612 and GSXT20191014 Provides Novel Insights Into Their Genetic Variability and Virulence
    Denghui Chen, Xionghui Zhong, Jian Cui, Hailong Li, Rui Han, Xiangqing Yue, Jianming Xie, Jungen Kang
    Frontiers in Microbiology.2022;[Epub]     CrossRef
  • Inheritance of Black Rot Resistance and Development of Molecular Marker Linked to Xcc Races 6 and 7 Resistance in Cabbage
    Jeong-Eui Hong, Khandker Shazia Afrin, Md Abdur Rahim, Hee-Jeong Jung, Ill-Sup Nou
    Plants.2021; 10(9): 1940.     CrossRef
  • Advances in Multi-Omics Approaches for Molecular Breeding of Black Rot Resistance in Brassica oleracea L.
    Ranjan K. Shaw, Yusen Shen, Jiansheng Wang, Xiaoguang Sheng, Zhenqing Zhao, Huifang Yu, Honghui Gu
    Frontiers in Plant Science.2021;[Epub]     CrossRef
  • Early Defense Mechanisms of Brassica oleracea in Response to Attack by Xanthomonas campestris pv. campestris
    Lu Lu, Sokrat G. Monakhos, Yong Pyo Lim, So Young Yi
    Plants.2021; 10(12): 2705.     CrossRef
  • Molecular marking in breeding Brassica oleracea L. for resistance to Xanthomonas campestris pv. campestris
    Yuliya Makukha, Elena Dubina, S. Belousov, S. Roshchupkin
    E3S Web of Conferences.2021; 285: 03009.     CrossRef
  • Advances in Genetics and Molecular Breeding of Broccoli
    Fengqing Han, Yumei Liu, Zhiyuan Fang, Limei Yang, Mu Zhuang, Yangyong Zhang, Honghao Lv, Yong Wang, Jialei Ji, Zhansheng Li
    Horticulturae.2021; 7(9): 280.     CrossRef
  • PCR identification of genes of resistance to black rot in white cabbage using SSR-markers
    Yuliya Makukha, A. Asaturova, E. Esaulenko
    BIO Web of Conferences.2020; 21: 00013.     CrossRef
  • Antibacterial Radicicol Analogues from Pochonia chlamydosporia and Their Biosynthetic Gene Cluster
    Feifei Qin, Yan Li, Runmao Lin, Xi Zhang, Zhenchuan Mao, Jian Ling, Yuhong Yang, Xia Zhuang, Shushan Du, Xinyue Cheng, Bingyan Xie
    Journal of Agricultural and Food Chemistry.2019; 67(26): 7266.     CrossRef
  • Molecular-genetic marking of Brassica L. species for resistance against various pathogens: achievements and prospects
    F. A. Berensen, O. Yu. Antonova, А. M. Artemyeva
    Vavilov Journal of Genetics and Breeding.2019; 23(6): 656.     CrossRef
  • Identification of NBS-encoding genes linked to black rot resistance in cabbage (Brassica oleracea var. capitata)
    Khandker Shazia Afrin, Md Abdur Rahim, Jong-In Park, Sathishkumar Natarajan, Hoy-Taek Kim, Ill-Sup Nou
    Molecular Biology Reports.2018; 45(5): 773.     CrossRef
  • Development of race-specific molecular marker for Xanthomonas campestris pv. campestris race 3, the causal agent of black rot of crucifers
    Khandker Shazia Afrin, Md Abdur Rahim, Mehede Hassan Rubel, Sathishkumar Natarajan, Jae-Young Song, Hoy-Taek Kim, Jong-In Park, Ill-Sup Nou, Christian Willenborg
    Canadian Journal of Plant Science.2018; 98(5): 1119.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Screening of Cabbage (Brassica oleracea L.) Germplasm for Resistance to Black Rot
Plant Breed. Biotech.. 2018;6(1):30-43.   Published online March 1, 2018
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Screening of Cabbage (Brassica oleracea L.) Germplasm for Resistance to Black Rot
Plant Breed. Biotech.. 2018;6(1):30-43.   Published online March 1, 2018
Close

Figure

  • 0
  • 1
  • 2
Screening of Cabbage (Brassica oleracea L.) Germplasm for Resistance to Black Rot
Image Image Image
Fig. 1 The disease reaction scoring criteria used in this study for black rot of cabbage. Scales: 0 = no visible symptoms; 1 = small necrosis or chlorosis near the inoculation point; 3 = typical small V-shaped lesion with black veins; 5 = typical lesion half way to the middle vein; 7 = typical lesion succeeding to the middle vein; and 9 = lesion reaching the middle vein (Vicente et al. 2002). 0, high resistant (HR); 1–3, resistant (R); 5–7, susceptible (S); 9, highly susceptible (HS).
Fig. 2 The resistant and susceptible cabbage lines against different races of Xanthomonas campestris pv. campestris (Xcc) at 2 weeks after inoculation. The letters a, b, c, d, e, f and g, represents Xcc race 1, 2, 3, 4, 5, 6 and 7, respectively.
Fig. 3 Chromosomes location of five reported polymorphic markers on Brassica oleracea.
Screening of Cabbage (Brassica oleracea L.) Germplasm for Resistance to Black Rot

Xanthomonas campestris pv. campestris (Xcc) races used for bioassay-based screening of cabbage lines.

Sl. No. Bacterial race/strains Source Reference
1 Xanthomonas campestris pv. campestris Race 1 (B100) UK Vicente et al. 2001
2 Xanthomonas campestris pv. campestris Race 2 (3849A) US
3 Xanthomonas campestris pv. campestris Race 3 (5212) UK
4 Xanthomonas campestris pv. campestris Race 4 (CFBP 5817) UK
5 Xanthomonas campestris pv. campestris Race 5 (3880) Australia
6 Xanthomonas campestris pv. campestris Race 6 (6181) Portugal
7 Xanthomonas campestris pv. campestris Race 7 (8450A) UK

List of markers with their primer sequence used in the molecular screening for black rot resistance in cabbage.

Sl. No. Markers Chromosome Primer sequence (5′……3′) Tm (°C) Size (bp) Marker type Reference
1 BoESSR291 C03 F: AAGCTGGGGATGGAGAAGAT
R: GCACCTAATCGAACCCCTTA
52 114 SSR Izzah et al. 2014
2 BoESSR216 C01 F: GGTTTCCGCTATGTCCAGAA
R: CGGAAGAAGACGTTGAGGAG
52 317 SSR Izzah et al. 2014
3 BoESSR089 C01 F: ATGATCAGCGAAACCACTCC
R: TGATACATCCCGTTTGCTCA
55 259 SSR Izzah et al. 2014
4 BoESSR145 C01 F: GGGCGAGGATGGTTACTACA
R: TCATACCCCAAGGCTATTTT
55 240 SSR Izzah et al. 2014
5 BoESSR726 C01 F: CAATGGGTTACGCATGGTTT
R: CGTTTGTGAAACAGCCATTG
55 228 SSR Izzah et al. 2014
6 SSR739 C03 F: TAGGGTGAAAGGGAAGCTCA
R: CGCTAATAATGGCGCTAAGG
52 182 SSR Saha et al. 2014
7 BnGMS301 C01 F: AATATGCAGCATTCTAGACAAA
R: ATCATTCTCGTGATGACACA
55 250 SSR Cheng et al. 2009
8 BoGMS0971 C08 F: TAATCCGAACAACACGAA
R: CACCCAATAAGCGATGAG
52 344 SSR Li et al. 2011
9 OI10G06 C06 F: GACAAGTTCCCTTGTAATGGC
R:TGTAATCATCACACATTTTGGG
52 109 SSR Li et al. 2011
10 Iso0857_371bc C09 F: AAGGAATTCCCCAGGATGTC
R: TTGGCAACCCTAATGCTTTT
51 477 InDel Lee et al. 2015

Comparison of bioassay and molecular screening results for black rot resistance in cabbage.

Sl. No. Lines Race 1 OI10G06 BnGMS301 BoESSR726 BoESSR291 Race 2 BoESSR291 OI10G06 BoESSR726 BoGMS0971




Pz) Gy) Pz) Gy)
1 SCNU-C-106 HSu) + + + + HS + + +
2 SCNU-C-107 n/at) + + HS + +
3 SCNU-C-3122 Sv) + + + HS + + + +
4 SCNU-C-3270 S + + + S + + + +
5 SCNU-C-3273 S + + + HRx) + +
6 SCNU-C-3305 HS + + + + S + + + +
7 SCNU-C-3328 S + + HS + + +
8 SCNU-C-3412 S + + + + HS + + +
9 SCNU-C-3414 S + + n/a +
10 SCNU-C-3449 HS + + + + HS + + + +
11 SCNU-C-3470 n/a + + + n/a + + +
12 SCNU-C-3631 S + + HR +
13 SCNU-C-3637 S + + + HR + +
14 SCNU-C-3639 S + + + HR + + +
15 SCNU-C-4059 S + + + + S + + +
16 SCNU-C-4066 S + + + S + +
17 SCNU-C-4071 S + + + S + +
18 SCNU-C-4072 n/a + + + HR + +
19 SCNU-C-4073 S + + + + HR + + +
20 SCNU-C-4074 Rw) + n/a +
21 SCNU-C-4085 S + + + + S + + +
22 SCNU-C-4105 S + + + S + + +
23 SCNU-C-4118 S + S + +
24 SCNU-C-4161 HS + + + + S + + +
25 SCNU-C-4168 S + + S +
26 SCNU-C-4302 HS + + + HS + + +
27 SCNU-C-4320 HS + + + + HS + + +
Matched 20.0 19.0 19.0 16.0 17.0 17.0 15.0 14.0
Not matched 4.0 5.0 5.0 9.0 6.0 6.0 8.0 9.0
% Adaptability 83.3 79.2 79.2 66.7 73.9 73.9 65.2 60.9
Sl. No. Lines Race 3 BnGMS301 BoESSR291 BoESSR726 OI10G06 Race 4 BnGMS301 BoESSR726 OI10G06 BoESSR291




Pz) Gy) Pz) Gy)
1 SCNU-C-106 HS + + + + n/a + + + +
2 SCNU-C-107 HS + + S + +
3 SCNU-C-3122 HS + + + HS + + +
4 SCNU-C-3270 HS + + + S + + +
5 SCNU-C-3273 R + + + S + + +
6 SCNU-C-3305 S + + + + HS + + + +
7 SCNU-C-3328 HS + + HS + +
8 SCNU-C-3412 HS + + + + S + + + +
9 SCNU-C-3414 S + + S + +
10 SCNU-C-3449 HS + + + + HS + + + +
11 SCNU-C-3470 S + + + S + + +
12 SCNU-C-3631 S + + S + +
13 SCNU-C-3637 S + + + S + + +
14 SCNU-C-3639 S + + + S + + +
15 SCNU-C-4059 S + + + + S + + + +
16 SCNU-C-4066 HS + + + HS + + +
17 SCNU-C-4071 HS + + + S + + +
18 SCNU-C-4072 HS + + + n/a + + +
19 SCNU-C-4073 HS + + + + S + + + +
20 SCNU-C-4074 HS + HS +
21 SCNU-C-4085 HS + + + + HS + + + +
22 SCNU-C-4105 HS + + + S + + +
23 SCNU-C-4118 R + S +
24 SCNU-C-4161 HS + + + + n/a + + + +
25 SCNU-C-4168 HS + + S + +
26 SCNU-C-4302 HS + + + S + + +
27 SCNU-C-4320 HS + + + + HS + + + +
Matched 22.0 21.0 20.0 19.0 19.0 18.0 17.0 16.0
Not matched 5.0 6.0 7.0 8.0 5.0 6.0 7.0 8.0
% Adaptability 81.5 77.8 74.1 70.1 79.2 75.0 70.8 66.7
Sl. No. Lines Race 5 BnGMS301 BoESSR726 BoESSR291 OI10G06 Race 6 BnGMS301 BoESSR726 BoESSR291 OI10G06




Pz) Gy) Pz) Gy)
1 SCNU-C-106 HS + + + + HS + + + +
2 SCNU-C-107 HS + + HS + +
3 SCNU-C-3122 S + + + HS + + +
4 SCNU-C-3270 R + + + S + + +
5 SCNU-C-3273 n/a + + + HS + + +
6 SCNU-C-3305 S + + + + HS + + + +
7 SCNU-C-3328 HS + + HS + +
8 SCNU-C-3412 S + + + + S + + + +
9 SCNU-C-3414 n/a + + HS + +
10 SCNU-C-3449 HS + + + + S + + + +
11 SCNU-C-3470 n/a + + + R + + +
12 SCNU-C-3631 S + + HS + +
13 SCNU-C-3637 HS + + + HS + + +
14 SCNU-C-3639 HS + + + S + + +
15 SCNU-C-4059 S + + + + S + + + +
16 SCNU-C-4066 HS + + + HS + + +
17 SCNU-C-4071 HS + + + HS + + +
18 SCNU-C-4072 HS + + + HS + + +
19 SCNU-C-4073 HS + + + + HS + + + +
20 SCNU-C-4074 n/a + S +
21 SCNU-C-4085 S + + + + HS + + + +
22 SCNU-C-4105 HS + + + S + + +
23 SCNU-C-4118 R + R +
24 SCNU-C-4161 S + + + + HS + + + +
25 SCNU-C-4168 HS + + HS + +
26 SCNU-C-4302 HS + + + S + + +
27 SCNU-C-4320 HS + + + + HS + + + +
Matched 21.0 18.0 17.0 16.0 22.0 22.0 19.0 18.0
Not matched 2.0 5.0 6.0 7.0 5.0 5.0 8.0 9.0
% Adaptability 91.3 78.3 73.9 69.6 81.5 81.5 70.4 66.7
Sl. No. Lines Race 7 BnGMS301 BoESSR291 OI10G06 BoESSR726


Pz) Gy)
1 SCNU-C-106 HS + + + +
2 SCNU-C-107 R + +
3 SCNU-C-3122 HS + + +
4 SCNU-C-3270 HR + + +
5 SCNU-C-3273 n/a + + +
6 SCNU-C-3305 S + + + +
7 SCNU-C-3328 HS + +
8 SCNU-C-3412 HS + + + +
9 SCNU-C-3414 n/a + +
10 SCNU-C-3449 S + + + +
11 SCNU-C-3470 HR + + +
12 SCNU-C-3631 HS + +
13 SCNU-C-3637 HS + + +
14 SCNU-C-3639 S + + +
15 SCNU-C-4059 HR + + + +
16 SCNU-C-4066 S + + +
17 SCNU-C-4071 HS + + +
18 SCNU-C-4072 HS + + +
19 SCNU-C-4073 S + + + +
20 SCNU-C-4074 HS +
21 SCNU-C-4085 HS + + + +
22 SCNU-C-4105 HS + + +
23 SCNU-C-4118 HS +
24 SCNU-C-4161 HS + + + +
25 SCNU-C-4168 HS + +
26 SCNU-C-4302 S + + +
27 SCNU-C-4320 HS + + + +
Matched 18.0 17.0 17.0 16.0
Not matched 7.0 8.0 8.0 9.0
% Adaptability 72.0 68.0 68.0 64.0

z)P, phenotype based on disease reaction;

y)G, genotype on molecular marker screening;

x)HR, high resistant;

w)R, resistant;

v)S, susceptible;

u)HS, high susceptible;

t)n/a, bioassay data not available.

The tested molecular markers and their location on Brassica oleracea genome.

Maker name Locationz) Description
BoGMS0971 C8:31754531..31754753 Intergenic region (Bo8g092870 and Bo8g092880)
BnGMS301 C1:15386406..15386643 Intergenic region (Bo1g053300 and Bo1g053310)
BoESSR291 C3:21846613..21846644 Promoter region of a gene cystathionine gamma-synthase (Bo3g055310)
BoESSR726 C1:15967972..15968174 Intergenic region (Bo1g054960 and Bo1g054970)
OI10G06 C6:29898028..29898121 Intergenic region (Bo6g095520 and Bo6g095530)

z)The chromosomal locations are shown according to the ENSEMBL-based Brassica oleracea genome database.

Genes around the tested polymorphic molecular markers in Brassica oleracea genome.

Makers Gene ID Description

NCBIz) TAIRy) Bolbasex)
BoGMS0971 Bo8g092870 V-type proton ATPase subunit D-like Vacuolar ATP synthase subunit D V-type proton ATPase subunit D-like
Bo8g092880 Citrate synthase 2, peroxisomal-like Citrate synthase 1 Citrate synthase-like, large alpha subdomain
BnGMS301 Bo1g053300 (E)-beta-ocimene synthase, chloroplastic Terpene synthase 02 Terpene synthase-like
Bo1g053310 (E)-beta-ocimene synthase, chloroplastic Terpene synthase 02 Uncharacterized protein
BoESSR291 Bo3g055310 Cystathionine gamma-synthase Cystathionine gamma-synthase Cystathionine gamma-synthase (CGS)
BoESSR726 Bo1g054960 Uncharacterized ABC transporter family protein ABC transporter D family member 2, chloroplastic
Bo1g054970 Uncharacterized Mitochondrial transcription termination factor family protein Mitochodrial transcription termination factor-related
OI10G06 Bo6g095520 Uncharacterized Unknown protein Putative uncharacterized protein
Bo6g095530 Protein argonaute 7-like Argonaute family protein Protein argonaute

z)The National Center for Biotechnology Information (NCBI);

y)The Arabidopsis Information Resource (TAIR);

x)The Brassica oleracea Genome Database (Bolbase).

Table 1 Xanthomonas campestris pv. campestris (Xcc) races used for bioassay-based screening of cabbage lines.
Table 2 List of markers with their primer sequence used in the molecular screening for black rot resistance in cabbage.
Table 3 Comparison of bioassay and molecular screening results for black rot resistance in cabbage.

P, phenotype based on disease reaction;

G, genotype on molecular marker screening;

HR, high resistant;

R, resistant;

S, susceptible;

HS, high susceptible;

n/a, bioassay data not available.

Table 4 The tested molecular markers and their location on Brassica oleracea genome.

The chromosomal locations are shown according to the ENSEMBL-based Brassica oleracea genome database.

Table 5 Genes around the tested polymorphic molecular markers in Brassica oleracea genome.

The National Center for Biotechnology Information (NCBI);

The Arabidopsis Information Resource (TAIR);

The Brassica oleracea Genome Database (Bolbase).