Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Differential Expression Pattern of Lignin Biosynthetic Genes in Dwarf Cherry Tomato (Solanum lycopersicum var. cerasiforme)

Plant Breeding and Biotechnology 2019;7(3):229-236.
Published online: September 1, 2019

1Department of Horticulture, Sunchon National University, Suncheon 57922, Korea

2Department of Genetics and Plant Breeding, Sher-e-Bangla Agricultural University, Dhaka-1207, Bangladesh

*Ill-Sup Nou, nis@sunchon.ac.kr, Tel: +82-61-750-3249, Fax: +82-61-750-5389
• Received: July 9, 2019   • Revised: August 10, 2019   • Accepted: August 12, 2019

Copyright © 2019 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 20 Views
  • 0 Download
  • 3 Crossref
prev next
  • Cherry tomatoes are highly nutritious, flavory with a pleasant taste and are becoming increasingly popular to the consumers. The cherry tomato cv. ‘Minichal’ produced some dwarf plants along with normal plants. Lignin, a phenolic biopolymer is the key component of cell walls in plants. Here, we analyzed lignin biosynthesis-related genes in leaves, inflorescences and fruits of dwarf and normal cherry tomato plants by reverse-transcription quantitative PCR (RT-qPCR). Among analyzed genes, SlCCOAOMT1, SlCCOAOMT2, SlCCOAOMT3, SlF5H, and SlCOMT showed significantly higher expressions, in leaf and inflorescence of dwarf plants compared with the normal plants, while SlPAL1 showed a significantly higher expression only in the leaves. On the contrary, SlHCT and SlC3H showed significantly lower expression levels in the leaves and inflorescences of dwarf plants compared with normal ones. The results suggest that SlHCT and SlC3H might have an impact on the dwarf cherry tomato plants.
Cherry tomatoes (Solanum lycopersicum var. cerasiforme) are the ancestor of the domesticated tomato (large-fruited) which are characterized by small fruits (1.5–3.5 cm in diameter) on elongated panicles (Hobson and Bedford 1989; Ranc et al. 2008). They are highly nutritious (carotenoids, ascorbate, free amino acids, flavonoids), highly flavored, with a pleasant taste and intensive-colored due to high lycopene content compared to cultivated large-fruited tomato (Kobryn and Hallmann 2005). Besides, they are a good source of health promoting bioactive compounds, including carotenoids and phenolics which are known to protect humans against cancer (Choi et al. 2011; Rosales et al. 2011; Raiola et al. 2015). Considering these properties, cherry tomatoes are becoming popular to the consumers. In the present work, we used a cherry tomato cultivar ‘Minichal’, which exhibited defects in growth and development, including reduced internode length, branched inflorescence and smaller fruits compared with the normal phenotype of the same cultivar (Rahim et al. 2018). The dwarf plants of ‘Minichal’ drastically reduced the yield and quality.
Lignin is the complex phenolic biopolymer which plays an important role on plant growth and development (Rogers and Campbell 2004; Yoon et al. 2015). It ranked second next to cellulose among the terrestrial biopolymers (Boerjan et al. 2003). Lignin is the key structural component of the cell walls of land plants, more specifically the tracheids and vessel elements of the xylem (Rogers and Campbell 2004). Lignin is accumulated in the cell walls during secondary thickening which gave the mechanical strength and efficient transport of water and solutes (Boerjan et al. 2003).
In plants, lignins are biosynthesized via the phenylpropanoid pathway which converts the key amino acid phenylalanine to yield p-coumaroyl CoA via three enzymes including phenylalanine ammonia-lyase (PAL), cinnamic acid 4-hydroxylase (C4H) and 4-coumarate CoA ligase (4CL) (Goicoechea et al. 2005). Then, the p-coumaroyl CoA is catalysed by a series of enzymes [viz. p-hydroxycinnamoyl CoA: shikimate p-hydroxycinnamoyl transferase (HCT); coumarate 3-hydroxylase (C3H); caffeoyl-CoA O-methyltransferase (CCoAOMT); ferulate 5-hydroxylase (F5H); caffeic acid 3-O-methyltransferase (COMT); cinnamoyl-CoA reductase (CCR); and cinnamyl alcohol dehydrogenase (CAD)] to produce monolignols (p-coumaryl, coniferyl and syringyl alcohols) (Goicoechea et al. 2005). Then, these monolignols are polymerized in the cell walls to produce lignin (hydroxyphenyl (H), guaiacyl (G) and sinapyl (S) lignin) (Goicoechea et al. 2005). Subsequently, monolignols undergo dehydrogenation which is catalyzed by peroxidases, laccases, or other phenol oxidases (Liu 2012).
Most of the structural genes of lignin biosynthesis have the common AC element (cis-element) (Zhong and Ye 2009). The MYB TFs viz. AtMYB58 and AtMYB63 regulate the transcription of the lignin biosynthetic genes via binding the AC elements (Zhong and Ye 2009). Furthermore, two Arabidopsis MYBs such AtMYB46 and AtMYB83 are involved in the regulation of secondary wall biosynthetic pathway including lignin (Zhong et al. 2013). The transgenic Arabidopsis and poplar plants overexpressing AtMYB46 and AtMYB83 can activate the genes involved in secondary wall biosynthesis (McCarthy et al. 2009; Zhong et al. 2013). These MYB TFs also have functional redundancy in the regulation of secondary wall biosynthetic genes since silencing either of them (MYB46 or MYB83) does not hamper the secondary wall formation (McCarthy et al. 2009).
Recent research revealed that suppression of important genes of the lignin biosynthetic pathway, including CAD and CCR genes leads to pant dwarfism and male sterility in Arabidopsis (Chabannes et al. 2001; Thévenin et al. 2011). Furthermore, silencing of the CCR and CAD genes in both Arabidopsis and tobacco also caused dwarfism compared to their normal phenotype (Jones et al. 2001; Abbott et al. 2002; Sibout et al. 2005). Therefore, in this study, we aimed to analyze the genes involved in lignin biosynthesis in normal and dwarf plants of cherry tomato.
Plant materials
The normal and dwarf plants of the cherry tomato cv. ‘Minichal’ were used in this study (Fig. 1). The dwarf plants are characterized by short internodes, extremely branched inflorescence and reduced fruit size compared with the normal phenotype. Plants were grown in a glass-house in the Department of Horticulture, Sunchon National University, Suncheon, Republic of Korea. For gene expression studies, leaf, inflorescence and fruit tissues were sampled from both the dwarf and normal plants with three biological replications and frozen in liquid nitrogen followed by storage at −80°C until RNA isolation.
Total RNA isolation and cDNA synthesis
The collected samples were ground into powder with mortar and pestle in liquid nitrogen. Around 100 mg of well-ground tissues were used for total RNA isolation with the RNeasy Mini Kit (Qiagen, USA) following the manufacturer’s instruction. In the next step, the quantity and quality of RNA samples were ascertained using a Nano-Drop spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA) and agarose gel electrophoresis. Thereafter, cDNA was synthesized from 1 μg of total RNA for each sample with a cDNA synthesis kit ‘SuperScript® III First-Strand Synthesis System’ (Invitrogen, Carlsbad, CA, USA).
Identification of genes related to lignin biosynthesis
The lignin biosynthetic genes in tomato were identified via BLAST analysis of Arabidopsis genes related to lignin biosynthesis as previously described by Shafi et al. (2014). To do this, we retrieved the deduced amino acid sequences of Arabidopsis lignin biosynthetic genes from ‘The Arabidopsis Information Resource’ (TAIR, https://www.arabidopsis.org) and blasted against S. lycopersicum ITAG2.4 in the ‘Sol Genomics Network’ (https://solgenomics.net). After that, a phylogenetic tree was built using the MEGA6.0 program (https://www.megasoftware.net/).
Gene expression analysis by RNA-seq data
The RNA-seq data of normal and dwarf plants of cherry tomato cv. ‘Minichal’ used in this study were previously reported by our research group (Rahim et al. 2018).
Gene expression analysis by RT-qPCR
The gene expression pattern of lignin biosynthesis-related genes was determined by RT-qPCR with ‘Light-Cycler 96’ (Roche, Mannheim, Germany). The genespecific primers were designed (Table 1) with ‘Primer3Plus’ online tool (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). The reaction was performed in a 10 μL volume with ‘2x qPCRBIO SyGreen Blue Mix Lo-ROX’ (PCR Biosystems Ltd., London, UK). Total 45 ng/μL cDNA was used as a template for each reaction. The reaction condition was 95°C for 5 minutes, then 50 cycles of 95°C for 10 seconds, 60°C for 10 seconds and 72°C for 15 seconds. The gene expression patterns of all studied genes were determined using three biological and three technical replications. Finally, the relative expressions of the selected genes were analyzed using the comparative 2−ΔΔCt method (Livak and Schmittgen 2001) and Elongation factor-1alpha (SlEF1-a) was used as the reference gene.
Statistical analysis
ANOVA and significance tests were performed using Minitab 17 (Minitab Inc., USA). The mean separation was done with the Tukey’s pairwise comparison.
Gene selection
We analyzed two types of plants of a cherry tomato cultivar with dwarf and normal phenotypes in this study. Since dwarf plants had reduced internode lengths, branched inflorescence and smaller fruits, we looked for genes related to cell wall biosynthesis and modification (Fig. 1). In this study, we focused on genes related to lignin biosynthesis which is the major structural component of the cell wall. The lignin biosynthesis-related genes in tomato were selected through BLAST analysis of corresponding Arabidopsis genes (Shafi et al. 2014). We selected a total of 8 genes (SlPAL1, Solyc09g007920; SlHCT, Solyc03g117600; SlC3H, Solyc01g096670; SlCCOAOMT1, Solyc02g093270; SlCCOAOMT2, Solyc10g050160; SlCCOAOMT3, Solyc 01g107910; SlF5H, Solyc02g084570; SlCOMT, Solyc03g 080180) involved in lignin biosynthesis based on high similarity with Arabidopsis sequence and visualized in a phylogenetic tree (Fig. 2).
Gene expression patterns by RNA-seq data
We analyzed the selected lignin biosynthesis-related genes via the FPKM-values (fragments per kilobase of transcript per million mapped reads) of the cherry tomato RNA-seq data reported by our research group (Rahim et al. 2018) and are presented in Fig. 3. Among the lignin biosynthesis genes, the expression of SlHCT (Solyc03g 117600) and SlC3H (Solyc01g096670) were declined in dwarf plants compared with normal plants while the expression of SlPAL1 (Solyc09g007920), SlCCOAOMT1 (Solyc02g093270), SlCCOAOMT2 (Solyc10g050160), SlCCOAOMT3 (Solyc01g107910), SlF5H (Solyc02g084570) and SlCOMT (Solyc03g080180) were relatively higher in dwarf plants compared to normal plants.
Gene expression patterns by RT-qPCR
We further determined the expression pattern of selected genes related to lignin biosynthesis by RT-qPCR (Fig. 4). The expression of SlCCOAOMT1 (Solyc02g093270), SlCCOAOMT2 (Solyc10g050160), SlCCOAOMT3 (Solyc 01g107910), SlF5H (Solyc02g084570) and SlCOMT (Solyc03g080180) were significantly higher both in the leaves and inflorescences of dwarf plants compared to the normal ones while SlPAL1 (Solyc09g007920) showed significantly higher expression only in the leaves. Nonetheless, the expressions of these genes were not significantly different in fruits between dwarf and normal plants except SlCCOAOMT1 (Solyc02g093270). On the other hand, SlHCT (Solyc03g117600) and SlC3H (Solyc01g096670) showed opposite expression patterns being significantly lower in the leaves and inflorescences of dwarf plants compared with normal ones while they did not differ in the fruits.
In this study, we analyzed a cherry tomato with reduced plant growth and development and characterized by short internode, highly branched inflorescence and smaller fruits compared to the normal one. Lignin is a key structural component of cell walls and lignification is a crucial process for normal plant growth and development (Li et al. 2010). Besides, there is a correlation between expression levels of genes related to lignin biosynthesis and plant growth (Xue et al. 2019). Therefore, we analyzed the transcript levels of lignin biosynthetic genes in dwarf and normal plants of cherry tomato by RT-qPCR.
Our results revealed that the expression level of two important genes (SlHCT and SlC3H) of the lignin biosynthetic pathway were down-regulated in different tissues of dwarf plants compared with normal plants except in fruit tissues (Fig. 4). The FPKM expression of these genes also correlates with the RT-qPCR expression data (Figs. 3, 4). The results revealed that the down-regulation of SlHCT and SlC3H might reduce the lignin levels in dwarf tomato plants. In Arabidopsis, deficiency in HCT or C3H of the phenylpropanoid pathway exhibited decreased lignin content, increased flavonoids content, and reduced plant growth (Li et al. 2010). Gallego-Giraldo et al. (2011) reported that down-regulation of HCT results in a reduced lignin content as well as stunted plants in both Arabidopsis and alfalfa. In the contrary, the enhanced lignin content, and decreased plant height and root length were reported in transgenic Arabidopsis plants overexpressing pear MYB169 (Xue et al. 2019). Recently, Rahim et al. (2018) reported that 3beta-hydroxysteroid-dehydrogenase (3BETAHSD/D2), 7-dehydrocholesterol reductase (DWF5), and delta(24)-sterol reductase (DIM) genes were directly or indirectly involved in dwarfism in cherry tomato via affecting steroid biosynthesis.
In conclusion, our results indicate that SlHCT and SlC3H might reduce the lignin content leading to the dwarfism in the analyzed cherry tomato plants. We assume that further functional analysis of these genes will elucidate the molecular mechanism of dwarfism in cherry tomato.
This research was financially supported by the Golden Seed Project (Center for Horticultural Seed Development, grant no. 213007-05-3-CG100) of the Ministry of Agriculture, Food and Rural Affairs (MAFRA), Republic of Korea.
Fig. 1
Phenotypes of dwarf and normal plants of the cherry tomato cv. ‘Minichal’ used in this study.
pbb-7-229f1.jpg
Fig. 2
Phylogenetic analysis of putative lignin biosynthetic genes in Solanum lycopersicum and their homologs from Arabidopsis thaliana. The tree was constructed by the neighbor-joining method using 1000 bootstrap values with MEGA6.0 software (https://www.megasoftware.net/). The deduced amino acid sequences of S. lycopersicum and A. thaliana were retrieved from ‘Sol Genomics Network’ and ‘TAIR’. The red and green circles indicate lignin biosynthetic genes in S. lycopersicum and A. thaliana, respectively.
pbb-7-229f2.jpg
Fig. 3
Heatmap representation of the expression pattern of genes involved in lignin biosynthesis genes in cherry tomato lines based on the FPKM (fragments per kilobase of transcript per million mapped reads) values obtained via leaf transcriptome sequencing data of dwarf and normal plants of cherry tomato. Red and blue colors indicate the maximum and minimum FPKM values, respectively.
pbb-7-229f3.jpg
Fig. 4
Expression patterns of lignin biosynthetic genes determined by the RT-qPCR in dwarf and normal plants of a cherry tomato cv. ‘Minichal’. Error bars denote ± SE of the means of three technical replications. Letters above each bar indicates significant differences.
pbb-7-229f4.jpg
Table 1
List of primers used for gene expression analysis by RT-qPCR.
Table 1
Gene Accession Gene Name Forward sequence (5′→3′) Reverse sequence (5′→3′) Tm Length
Solyc09g007920 SlPAL1 TACGTGTTTGCCTATGCTGATG CGGCCTTTAATTCGTCCTC 53/51.5 166
Solyc03g117600 SlHCT CCCTCCTCCGTGCTCGTGA CCCGGGTTAGTTTGAAGATTGACA 58.2/58.1 147
Solyc01g096670 SlC3H CTGCAATGCGTGGCCAAGGAAGC TCGCGAGCAACAGCCCAGACATT 66.3/64.5 149
Solyc01g107910 SlCCOAOMT6 ATTTTCGAGAGGGCCCTGCTTTAC ATCCGATCACACCACCAACTTTCA 59.9/59.1 162
Solyc10g050160 SlCCOAOMT5 GAGAGCCAGAATCCATGAAAGAAC AGGGCTGTAGCAAGGAGGGAG 55.1/56.3 175
Solyc02g093270 SlCCOAOMT GAGAGCCTGAAGCCATGAAAGAGC GAGCCATGGCAGTAGCAAGCAGAG 59.5/61.1 180
Solyc02g084570 SlF5H
(CYP84A1)
CGGACATGGCTTTTGCTGACTAC TGATGTGCCCGTGTTGGTTG 57.6/57.3 158
Solyc03g080180 SlCOMT GGTGGTGGAACAGGGGCTACT TAAACAATGCTCATCGCTCCAATC 56.6/57.1 210
Solyc06g005060
(X14449)
SlEF 1-a* GCTGCTGTAACAAGATGGATGC GGGGATTTTGTCAGGGTTGTAA 54/54.5 119

*Primer sequences were used from (Povero et al. 2011).

  • Abbott JC, Barakate A, Pinçon G, Legrand M, Lapierre C, Mila I, et al. 2002. Simultaneous suppression of multiple genes by single transgenes. Down-regulation of three unrelated lignin biosynthetic genes in tobacco. Plant Physiol. 128: 844-853.
  • Boerjan W, Ralph J, Baucher M. 2003. Lignin biosynthesis. Annu Rev Plant Bio. 54: 519-546.
  • Chabannes M, Barakate A, Lapierre C, Marita JM, Ralph J, Pean M, et al. 2001. Strong decrease in lignin content without significant alteration of plant development is induced by simultaneous down-regulation of cinnamoyl CoA reductase (CCR) and cinnamyl alcohol dehydrogenase (CAD) in tobacco plants. Plant J. 28: 257-270.
  • Choi SH, Kim HR, Kim HJ, Lee IS, Kozukue N, Levin CE, et al. 2011. Free amino acid and phenolic contents and antioxidative and cancer cell-inhibiting activities of extracts of 11 greenhouse-grown tomato varieties and 13 tomato-based foods. J Agric Food Chem. 59: 12801-12814.
  • Gallego-Giraldo L, Jikumaru Y, Kamiya Y, Tang Y, Dixon RA. 2011. Selective lignin downregulation leads to constitutive defense response expression in alfalfa (Medicago sativa L.). New Phytol. 190: 627-639.
  • Goicoechea M, Lacombe E, Legay S, Mihaljevic S, Rech P, Jauneau A, et al. 2005. Eg MYB2, a new transcriptional activator from Eucalyptus xylem, regulates secondary cell wall formation and lignin biosynthesis. Plant J. 43: 553-567.
  • Hobson GE, Bedford L. 1989. The composition of cherry tomatoes and its relation to consumer acceptability. J Hortic Sci. 64: 321-329.
  • Jones L, Ennos AR, Turner SR. 2001. Cloning and characterization of irregular xylem4 (irx4): a severely lignin-deficient mutant of Arabidopsis. Plant J. 26: 205-216.
  • Kobryn J, Hallmann E. 2005. The effect of nitrogen fertilization on the quality of three tomato types cultivated on rockwool. Acta Hortic. 691: 341-348.
  • Li X, Bonawitz ND, Weng JK, Chapple C. 2010. The growth reduction associated with repressed lignin biosynthesis in Arabidopsis thaliana is independent of flavonoids. Plant Cell. 22: 1620-1632.
  • Liu CJ. 2012. Deciphering the enigma of lignification: Precursor transport, oxidation, and the topochemistry of lignin assembly. Mol Plant. 5: 304-317.
  • McCarthy RL, Zhong R, Ye ZH. 2009. MYB83 is a direct target of SND1 and acts redundantly with MYB46 in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell Physiol. 50: 1950-1964.
  • Povero G, Gonzali S, Bassolino L, Mazzucato A, Perata P. 2011. Transcriptional analysis in high-anthocyanin tomatoes reveals synergistic effect of Aft and atv genes. J Plant Physiol. 168: 270-279.
  • Rahim MA, Jung HJ, Afrin KS, Lee JH, Nou IS. 2018. Comparative transcriptome analysis provides insights into dwarfism in cherry tomato (Solanum lycopersicum var. cerasiforme). PLoS One. 13: e0208770
  • Raiola A, Del Giudice R, Monti D, Tenore G, Barone A, Rigano MM. 2015. Bioactive compound content and cytotoxic effect on human cancer cells of fresh and processed yellow tomatoes. Molecules. 21: 33
  • Ranc N, Muños S, Santoni S, Causse M. 2008. A clarified position for Solanum lycopersicum var. cerasiforme in the evolutionary history of tomatoes (Solanaceae). BMC Plant Biol. 8: 130
  • Rogers LA, Campbell MM. 2004. The genetic control of lignin deposition during plant growth and development. New Phytol. 164: 17-30.
  • Rosales MA, Cervilla LM, Sánchez-Rodríguez E, del Rubio-Wilhelmi MM, Blasco B, Ríos JJ, et al. 2011. The effect of environmental conditions on nutritional quality of cherry tomato fruits: evaluation of two experimental Mediterranean greenhouses. J Sci Food Agric. 91: 152-162.
  • Shafi A, Dogra V, Gill T, Ahuja PS, Sreenivasulu Y. 2014. Simultaneous over-expression of PaSOD and RaAPX in transgenic Arabidopsis thaliana confers cold stress tolerance through increase in vascular lignifications. PLoS One. 9: e110302
  • Sibout R, Eudes A, Mouille G, Pollet B, Lapierre C, Jouanin L, et al. 2005. CINNAMYL ALCOHOL DEHYDROGENASE-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell. 17: 2059-2076.
  • Thévenin J, Pollet B, Letarnec B, Saulnier L, Gissot L, Maia-Grondard A, et al. 2011. The simultaneous repression of CCR and CAD, Two enzymes of the lignin biosynthetic pathway, results in sterility and dwarfism in Arabidopsis thaliana. Mol Plant. 4: 70-82.
  • Xue C, Yao JL, Xue YS, Su GQ, Wang L, Lin LK, et al. 2019. PbrMYB169 positively regulates lignification of stone cells in pear fruit. J Exp Bot. 70: 1801-1814.
  • Yoon J, Choi H, An G, Zhang D. 2015. Roles of lignin biosynthesis and regulatory genes in plant development. J Integr Plant Biol. 57: 902-912.
  • Zhong R, McCarthy RL, Haghighat M, Ye ZH. 2013. The poplar MYB master switches bind to the SMRE site and activate the secondary wall biosynthetic program during wood formation. PLoS One. 8: e69219
  • Zhong R, Ye ZH. 2009. Transcriptional regulation of lignin biosynthesis. Plant Signal Behav. 4: 1028-1034.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Differential Expression Pattern of Lignin Biosynthetic Genes in Dwarf Cherry Tomato (Solanum lycopersicum var. cerasiforme)
Plant Breed. Biotech.. 2019;7(3):229-236.   Published online September 1, 2019
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Differential Expression Pattern of Lignin Biosynthetic Genes in Dwarf Cherry Tomato (Solanum lycopersicum var. cerasiforme)
Plant Breed. Biotech.. 2019;7(3):229-236.   Published online September 1, 2019
Close

Figure

  • 0
  • 1
  • 2
  • 3
Differential Expression Pattern of Lignin Biosynthetic Genes in Dwarf Cherry Tomato (Solanum lycopersicum var. cerasiforme)
Image Image Image Image
Fig. 1 Phenotypes of dwarf and normal plants of the cherry tomato cv. ‘Minichal’ used in this study.
Fig. 2 Phylogenetic analysis of putative lignin biosynthetic genes in Solanum lycopersicum and their homologs from Arabidopsis thaliana. The tree was constructed by the neighbor-joining method using 1000 bootstrap values with MEGA6.0 software (https://www.megasoftware.net/). The deduced amino acid sequences of S. lycopersicum and A. thaliana were retrieved from ‘Sol Genomics Network’ and ‘TAIR’. The red and green circles indicate lignin biosynthetic genes in S. lycopersicum and A. thaliana, respectively.
Fig. 3 Heatmap representation of the expression pattern of genes involved in lignin biosynthesis genes in cherry tomato lines based on the FPKM (fragments per kilobase of transcript per million mapped reads) values obtained via leaf transcriptome sequencing data of dwarf and normal plants of cherry tomato. Red and blue colors indicate the maximum and minimum FPKM values, respectively.
Fig. 4 Expression patterns of lignin biosynthetic genes determined by the RT-qPCR in dwarf and normal plants of a cherry tomato cv. ‘Minichal’. Error bars denote ± SE of the means of three technical replications. Letters above each bar indicates significant differences.
Differential Expression Pattern of Lignin Biosynthetic Genes in Dwarf Cherry Tomato (Solanum lycopersicum var. cerasiforme)

List of primers used for gene expression analysis by RT-qPCR.

Gene Accession Gene Name Forward sequence (5′→3′) Reverse sequence (5′→3′) Tm Length
Solyc09g007920 SlPAL1 TACGTGTTTGCCTATGCTGATG CGGCCTTTAATTCGTCCTC 53/51.5 166
Solyc03g117600 SlHCT CCCTCCTCCGTGCTCGTGA CCCGGGTTAGTTTGAAGATTGACA 58.2/58.1 147
Solyc01g096670 SlC3H CTGCAATGCGTGGCCAAGGAAGC TCGCGAGCAACAGCCCAGACATT 66.3/64.5 149
Solyc01g107910 SlCCOAOMT6 ATTTTCGAGAGGGCCCTGCTTTAC ATCCGATCACACCACCAACTTTCA 59.9/59.1 162
Solyc10g050160 SlCCOAOMT5 GAGAGCCAGAATCCATGAAAGAAC AGGGCTGTAGCAAGGAGGGAG 55.1/56.3 175
Solyc02g093270 SlCCOAOMT GAGAGCCTGAAGCCATGAAAGAGC GAGCCATGGCAGTAGCAAGCAGAG 59.5/61.1 180
Solyc02g084570 SlF5H
(CYP84A1)
CGGACATGGCTTTTGCTGACTAC TGATGTGCCCGTGTTGGTTG 57.6/57.3 158
Solyc03g080180 SlCOMT GGTGGTGGAACAGGGGCTACT TAAACAATGCTCATCGCTCCAATC 56.6/57.1 210
Solyc06g005060
(X14449)
SlEF 1-a* GCTGCTGTAACAAGATGGATGC GGGGATTTTGTCAGGGTTGTAA 54/54.5 119

*Primer sequences were used from (Povero et al. 2011).

Table 1 List of primers used for gene expression analysis by RT-qPCR.

Primer sequences were used from (Povero et al. 2011).