Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Rapid Communication

Development and Validation of KASP Markers for Stv-bi, a Rice Stripe Virus Resistance Gene in Rice (Oryza sativa L.)

Plant Breeding and Biotechnology 2020;8(2):196-201.
Published online: June 1, 2020

Department of Southern Area Crop Science, National Institute of Crop Science, RDA, Miryang 50424, Korea

*Corresponding author Jong-Hee Lee, ccriljh@Korea.kr, Tel: +82-55-350-1168, Fax: +82-55-352-3059
• Received: April 1, 2020   • Revised: May 18, 2020   • Accepted: May 19, 2020

Copyright © 2020 by the Korean Society of Breeding Science

This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 275 Views
  • 1 Download
  • 8 Crossref
prev

Citations

Citations to this article as recorded by  Crossref logo
  • Genome-Wide Characterization of the PaO Gene Family and Pyramiding Effects of Superior Haplotypes on Yield-Related Traits in Sorghum
    Jinbiao Li, Haoxiang Li, Ruochen Zhang, Yizhong Zhang, Juanying Zhao, Xiaojuan Zhang, Huiyan Wang
    Agronomy.2025; 15(11): 2493.     CrossRef
  • KASP: a high-throughput genotyping system and its applications in major crop plants for biotic and abiotic stress tolerance
    Bhawna Dipta, Salej Sood, Vikas Mangal, Vinay Bhardwaj, Ajay Kumar Thakur, Vinod Kumar, Brajesh Singh
    Molecular Biology Reports.2024;[Epub]     CrossRef
  • Pyramiding effects of favorable haplotypes of loci on major fiber yield and quality traits in Upland Cotton (Gossypium hirsutum L.)
    Yingrui Zhao, Baojun Chen, Hongge Li, Jingjing Wang, Yinhua Jia, Zhaoe Pan, Daowu Hu, Zhen Peng, Yingxiao Li, Xu Gao, Peng Zhang, Liru Wang, Jun Peng, Shoupu He, Du Xiongming
    Industrial Crops and Products.2024; 217: 118805.     CrossRef
  • KASP mapping of QTLs for yield components using a RIL population in Basmati rice (Oryza sativa L.)
    Hamza Ashfaq, Reena Rani, Naila Perveen, Allah Ditta Babar, Umer Maqsood, Muhammad Asif, Katherine A. Steele, Muhammad Arif
    Euphytica.2023;[Epub]     CrossRef
  • Comparative Analysis between the ITS TaqMan SNP Genotyping Assay and CAPS for the Rapid Molecular Identification of Zoysia japonica and Zoysia sinica, Related Hybrid Lines, and the Habitat Distribution of Each Species
    Dae-Hwa Yang, Ok-Cheol Jeong, Yu-Ryang Kim, Mi-Jeong Kang, Yang-Ji Kim, Ji-Hi Son, Seong-Seop Han, Mi-Young Park, Il-Doo Jin, In-Ja Song, Min-Ji Hong, Hyeon-Jin Sun, Hong-Gyu Kang, Hyo-Yeon Lee
    Horticultural Science and Technology.2023; 41(4): 463.     CrossRef
  • Evaluation of Major Rice Varieties for Bakanae Disease Resistance in Korea
    Sais-Beul Lee, Ju-Won Kang, Ji-Yoon Lee, Gi-Un Seong, Youngho Kwon, So-Myeong Lee, Nkulu Rolly Kabang, Jun-Hyeon Cho, Seong-Hwan Oh, Dongjin Shin, Jong-Hee Lee, Ki-Won Oh, Dong-Soo Park
    Korean Journal of Breeding Science.2023; 55(2): 103.     CrossRef
  • New Transcriptome-Based SNP Markers for Noug (Guizotia abyssinica) and Their Conversion to KASP Markers for Population Genetics Analyses
    Sewalem Tsehay, Rodomiro Ortiz, Eva Johansson, Endashaw Bekele, Kassahun Tesfaye, Cecilia Hammenhag, Mulatu Geleta
    Genes.2020; 11(11): 1373.     CrossRef
  • Validation and Selection of Functional Allele-specific Molecular Markers to Analyze High-Molecular-Weight Glutenin Subunit Composition in Wheat
    Dongjin Shin, Jin-Kyung Cha, So-Myeong Lee, Jong-Min Ko, Jong-Hee Lee
    Korean Journal of Breeding Science.2020; 52(3): 235.     CrossRef

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Development and Validation of KASP Markers for Stv-bi, a Rice Stripe Virus Resistance Gene in Rice (Oryza sativa L.)
Plant Breed. Biotech.. 2020;8(2):196-201.   Published online June 1, 2020
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Development and Validation of KASP Markers for Stv-bi, a Rice Stripe Virus Resistance Gene in Rice (Oryza sativa L.)
Plant Breed. Biotech.. 2020;8(2):196-201.   Published online June 1, 2020
Close

Figure

  • 0
  • 1
Development and Validation of KASP Markers for Stv-bi, a Rice Stripe Virus Resistance Gene in Rice (Oryza sativa L.)
Image Image
Fig. 1 Sequence alignment in Indel7 region on chromosome 11 in RSV-resistant and RSV-susceptible genotypes. Their positions are indicated above the sequences. Arrows indicate the locations of the resistant allele (Third row Allele X and Reverse 1) and susceptible allele (Fourth row Allele Y) primers, respectively.
Fig. 2 Comparison of genotypes between RSV-KASP marker and InDel marker Indel7 closely linked to RSV. (A) Genotype of Indel7 in 263 Korean japonica rice varieties visualized on 3% agarose gel after mixing. (B) F2 plants derived from a cross between Ilpum (P1) and Saeilmi (P2). (C) BC1F1 population derived from a cross of Ilpum and Saeilmi for marker assisted backcross. (D-F) Plots of R/S-specific RSV-KASP marker-PCR products for MAS of RSV. MAS: marker assisted selection, RSV: Rice stripe virus, R: Resistance, S: susceptible.
Development and Validation of KASP Markers for Stv-bi, a Rice Stripe Virus Resistance Gene in Rice (Oryza sativa L.)

List of primer sequences used in the present study.

Marker Primers Primer sequences (5ʹ to 3ʹ) SNP
KASP Allele X AACGTGTAGTTGCCCGGCATC C Resistance
Allele Y AACGTGTAGTTGCCCGGCATG G Susceptible
Reverse 1 CAGCGAAATCCATGCCCTCGTAATT
Reverse 2 CAGCGAAATCCATGCCCTCGTAATT
InDel Indel7-F AAA TTC CAG TGC CCA AAA CC Kwon et al. (2012)
Indel7-R TCC TCA TGG AGC TCA TCC AAG

Classification of resistant and susceptible varieties using KASP marker for RSV resistance gene.

Ecotype Resistant Susceptible
Early maturing Danpyeng, Haedamssal, Hwawang, IS592BB, Jinkwang, Jogwang, Joil, Jonong, Joryeong, Jungmo1032, Jungmo1043, Keumo3, Manan, Pyeongwon, Sanhomi, Shinpyeong, Jopyeong (17 cultivars) Asemi, Asemi1, Baegilmi, BoSeog, Cheongbaekchal, CW92MR, Dunnae, Geumyoung, Goun, Guru, Haedeul, Handeul, Hanseol, Heugjinju, Hwangkeumbora, Jeogjinju, Jeogjinjuchal, Jinbu, Jinbuchal, Jinbuol, Jinhan, Jinmi, Jinok, Jinseolchal, Joami, Joan, Joeunheukmi, Jopum, Josaegheugchal, Joun, Junamjosaeng, Junghwa, Jungmo1024, Jungsan, Keumo, Manchoo, Manho, Manna, Namil, Namwon, Nukeunheugchal, Nunkeunheugchal1, Obong, Odae, Odae1, Ondami, Saeodae, Saesangju, Samcheon, Sandeuljinmi, Sangju, Sangjuchal, Seolbaek, Seolemi, Seongsan, Sinunbong, Sinunbong1, Sobaeg, Taebong, Unbaekchal, Unbong, Undoo, Unilchal, Unjang, Unkwang, Unmi, Weolbada (67 cultivars)
Mid maturing Bodrami, Borami, Boseogchal, Cheongdam, Cheongnam, Cheongpum, Dabo, Daebo, Daepyeong, Dongbo, Donghaejinmi, Gancheok, Gangchan, Geonyang2, Haechanmulgyeol, Haeoreumi, Haepum, Haepyeong, Haepyeongchal, Heugkwang, Hwaan, Hwabong, Hwajin, Hwanong, Hwanseonchal, Hwaseong, Hwayeong, Janngan, Jungmo1034, Jungsaenggold, Keumo2, Keumobyeo 1, Manjong, Manpung, Manwol, Palgong, Pungmi, Samdeog, Samkwang1, Sampyeong, Sangbo, Sangnambatbyeo, Seohyangheukmi, Seonpum, Shinbaeg, Sinseonchal, Sobi, Suan, Suryeonjinmi, Yeongan, Yeongdeog, Youngbo (52 cultivars) Giho, Boseogheugchal, Cheonga, Cheongan, Daejin, Daeripbyeo 1, Dodamssal, Gangbaek, Geuman, Geunnun, Heugseol, Hongjinju, Jinpum, Juan, Migwang, Naepung, Nongan, Nunbora, Saegyehwa, Seoan, Seolhyangchal, Sinbo, Sura, Goami3, Seoan1 (25 cultivars)
Mid late maturing Anbaek, Anmi, Aromi, Baekogchal, Boramchal, Boramchan, Cheongcheongjinmi, Cheonghaejinmi, Cheongho, Cheonghyangheukmi, Cheongun, Chilbo, Chindeul, Chinnong, Dacheong, Daean, Daecheong, Deuraechan, Dongan, Dongjin, Dongjin2, Geongganghongmi, Goami, Haiami, Hanam, Heughyang, Heugsujeong, Hoan, Hojin, Honong, Hopum, Huimangchan, Hwanam, Hwanggeummodeul, Hwangkeumnuri, Hwangrang, Hwansam, Hwasin, Hyeopum, Ilmil, Jeongjinju2, Jinbaek, Jinbo, Jinsumi, Junam, Jungmo1006, Keunpum, Kyehwa, Malgeumi, Manbaek, Manguem, Miho, Mihyang, Mipum, Misomi, MY298BB, MY299BK, Nanpyeong, Onnuri, Pungmi1, Saechilbo, Saeilmi, Saenuri, Saeshin, Samkwang, Seomyeong, Sindongjin, Sinjinbaek, Sodami, Sujin, Sukwang, Tamjin, Yangjo, Yechan, Younghojinmi, Youngjin (76 cultivars) Aranghangchal, Baegjinju, Baegjinju1, Baegseolchal, Daesan, Dami, danmi, Dongjin1, Dongjinchal, Geonyangmi, Goami2, Goami4, Gopum, Hangaru, Hanmaeum, Heugjinmi, Heugnam, Hopyung, Hyangnam, Ilpum, Manmi, Misiru, Saegoami, Saeilpum, Seolgaeng, Seopyeong(26 cultivars)
Table 1 List of primer sequences used in the present study.
Table 2 Classification of resistant and susceptible varieties using KASP marker for RSV resistance gene.