Skip to main navigation Skip to main content
  • KSBS
  • E-Submission

Plant Breed. Biotech. : Plant Breeding and Biotechnology

OPEN ACCESS
ABOUT
BROWSE ARTICLES
EDITORIAL POLICIES
FOR CONTRIBUTORS

Articles

Research Article

Phenotypic and Genotypic Analyses of Drought Tolerance in Korean and Tunisian Wheat Cultivars

Plant Breeding and Biotechnology 2014;2(2):139-150.
Published online: June 30, 2014

1Department of Biosystems and Biotechnology, Korea University, Seoul 136-713, Korea

2Division of Biotechnology, Korea University, Seoul 136-713, Korea

3Centre of Biotechnology of Sfax, B.P K.3038 Sfax, Tunisia

*Corresponding author: Yong Weon Seo, seoag@korea.ac.kr, Tel: +82-2-3290-3005, Fax: +82-2-3290-3501
• Received: April 27, 2014   • Revised: May 10, 2014   • Accepted: May 27, 2014

Copyright © 2014 The Korean Society of Breeding Science

This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

  • 287 Views
  • 3 Download
  • 7 Crossref
prev next
  • Common wheat (Triticum aestivum L.) and durum wheat (T. turgidum L. subsp. Durum) are major staple food crops in the world. However, their production are limited by environmental stress such as drought. In order to evaluate wheat’s response to drought, a total of 77 common wheat and durum wheat consisted of 19 Korean common wheat, 30 Tunisian common wheat and 28 Tunisian durum wheat were used in this study. Drought stress was applied for 21 days by suspending water application starting at the third leaf-expansion stage, followed by watering for the recovery of wheat until harvesting. Phenotypic parameters such as plant height, leaf length, tiller number, chlorophyll content, days to flowering and dry weight were scored during and after the treatment. Drought tolerance trait index (DTTI) and drought tolerance index (DTI) were calculated and used as criteria for selection of drought tolerance. At the end of treatment, most of the parameters except tiller numbers significantly decreased. Even after re-watering, plant height, leaf length, and dry weight continuously decreased. However, leaf chlorophyll content, and days to flowering of both stressed and non-stressed plants showed no significant differences. A total of 17 drought tolerance related simple sequence repeats (SSR) markers were used to identify genetic distance between Korean and Tunisian cultivars and elucidate possible use of marker systems for drought resistance. The common wheat and durum wheat cultivars formed different clusters for drought tolerance (resistance, moderate resistance, susceptible) using the SSR data. The results obtained in this study could help to increase genetic resources and breeding program for drought tolerance.
There is a current concern for future global food production using crops amidst an increasing world population (Brown & Funk 2008). Environmental problems such as drought, floods, and salinity have been reported to be more severe in some areas. In semi-arid areas, it is predicted that the grain yield of main cereal crops such as wheat and rice would decrease in the following 20 years (Lobell et al. 2008). To overcome these problems, crop improvements not only to increase yield but also to enhance tolerance to environmental stress are needed to improve global food security (Takeda & Matsuoka 2008).
Wheat (Triticum spp.) is a major staple food crop around the world (Munns et al. 2006). Common wheat (T. aestivum L.) and durum wheat (T. turgidum L. subsp. Durum) are major species of cultivated wheat. Drought stress is one of the global problems that limit crop production (Pan et al. 2002). About 32% of the wheat cultivating regions in developing countries experience drought stress during the growing season (Rajaram 2001).
Microsatellites or simple sequence repeats (SSR) have been widely utilized in plants as molecular markers for specific phenotypic traits (Gupta & Varshney 2000). Marker-assisted selection is useful for improving drought tolerance in wheat (Quarrie et al. 2003). SSR markers can show the genetic diversity for drought stress in wheat (El Siddig et al. 2013).
Recent studies involving in vitro selection using polyethylene glycol (PEG) or mannitol applied to generate water stress in plants were performed to develop drought- tolerant plants (Rai et al. 2011). However, some results of in vivo and in vitro studies are not necessarily associated and had to be considered individually (Farshadfar et al. 2012). Further, plant responses to PEG treatment could not indicate the drought tolerance for the entire plant growth period. Drought stress is a limiting factor to plant growth and dry matter (Jaleel et al. 2009); therefore, morphological traits can be used as a criteria for drought tolerance.
Korea is located in East Asia. The winter climate is cold and dry, whereas it is hot and humid during summer. In Korea, wheat is cultivated as a winter crop. Accordingly, wheat is subjected to drought stress during its early stages of growth in Korea.
Tunisia is located in North Africa; it is bordered by the Mediterranean Sea on the north and east, whereas the Sahara desert is positioned to its south. The climate in the north is warm with dry summer climate (Mediterranean climate), whereas the climate in the mid-south is semi-arid, where soil moisture barely meets wheat seedling growth and rainfall is low. Thus, in Tunisia, wheat experiences drought stress during its entire growing period.
The main objective of this study was to screen Korean common wheat, Tunisian common wheat, and Tunisian durum wheat cultivars for drought tolerance by using morphological traits and SSR markers to utilize them for future breeding programs.
Plant materials and experimental conditions
A total of 77 cultivars (49 common wheat lines and 28 durum wheat lines) were used in this study. Of these, 19 lines were Korean common wheat, and 58 lines were Tunisian wheat. Seeds of Korean wheat cultivars were provided by the National Institute of Crop Science (NICS), Rural Development Administration (RDA) of Korea. The Tunisian seeds were obtained from the National Agrobiodiversity Center (NAC), RDA and the National Plant Germplasm System (NPGS), United States Department of Agriculture (USDA). Information about the Tunisian common wheat and durum wheat accessions was obtained from the RDA-Genebank Information Center (http://www.genebank.go.kr/) and the Agricultural Research Service-Germplasm Resources Information Network (ARS-GRIN) (http://www.ars-grin.gov/).
The experiment was conducted during the 2013 growing season at the greenhouse of the Research Farm of Korea University (Namyangju-si, Gyeonggi-do, Korea). Two seeds were planted per pot (5′ 5′ 16 cm) filled with soil (Sunshine mix #1). Immediately after emergence, seedlings were thinned out to let each plant grow in each pot. Five plants per line from each control and treatment groups were subjected to the test.
All plants were grown with sufficient watering until the drought treatment was initiated. Drought stress was imposed at the fully expanded third leaf stage by suspending water application, whereas plants in the non-stressed condition received sufficient water every two days. The treatment was applied for three weeks. After the treatment, all plants were provided with sufficient water and grown until spike harvest.
Morphological traits measurement
Phenotypic parameters such as plant height, average leaf length, number of tillers per plant, and leaf chlorophyll content were measured at three time points (the initiation of treatment, the end of treatment, and 28 days after the end of treatment). The first measurement was used for normalization, and the others were used in calculating the degree of recovery after drought stress. Days to flowering and shoot dry weight were also scored.
Leaf chlorophyll content was recorded by using a portable chlorophyll meter (SPAD-502, Minolta, Japan). SPAD-502 can measure leaf chlorophyll content in a fast and nondestructive way (Yıldırım et al. 2001). Drought tolerance trait index (DTTI) and drought tolerance index (DTI) were calculated using the formula of Shahzad et al. (2012) and Ali et al. (2007). If the mean DTTI for a trait was >100, it indicates that the trait would increase during drought stress. Thus, the reciprocal of DTTI was used to calculate DTI.
DTTI=Value of trait under stress conditionValue of trait under non-stress condition×100DTI=The average of DTTIs
DTI was calculated as the mean of DTTIs for morphological traits showing the tendency to drought stress and recovery. Based on DTI, drought tolerance of 77 common wheat and durum wheat cultivars was determined as resistant lines, moderate lines, and susceptible lines.
SSR marker analysis
A total of 17 SSR primers were used in the analysis (Table 2). Information on the markers was obtained from the Agricultural Research Service-GrainGenes 2.0 (http://wheat.pw.usda.gov). Polymerase chain reactions (PCRs) were performed as described by Ciucă & Petcu (2009), with minor modification. PCR products were separated on agarose gel, and visualized and recorded using a gel documentation system.
The analysis was performed using the NTSYS-pc version 2.1 software using qualitative data for the similarity analysis, Sequential Agglomerative Hierarchical Nesting (SAHN) based on Unweighted Pair-Group Method with Arithmetic average (UPGMA) for the cluster analysis, and tree plot for the graphic visualization of dendrograms.
Morphological traits measurement
Agronomic traits of both control (non-stressed) and stressed plants were measured at three time points: at the initiation of the treatment, end of treatment (21 days without watering), and 28 days after the end of treatment. Compared to the non-stressed plant, plant height, leaf length, leaf chlorophyll content, and shoot dry weight of the treated plants decreased (Fig. 1A, B, and 2). Despite re-watering, the gap of those parameters between control and treatment increased.
DTTI analysis
The magnitude of DTTI at the end of the treatment indicates the response of the plants to drought stress. At the end of the treatment, the mean DTTI for plant height was 88.3 ± 1.57. Tunisian durum wheat cultivars showed the highest plant height (88.7 ± 2.18%), followed by the Korean common wheat cultivars and Tunisian common wheat cultivars (Table 3). The mean DTTI for average leaf length was 93.2 ± 1.88%. Korean common wheat cultivars showed the highest leaf length (94.7 ± 5.49%) followed by the Tunisian common wheat cultivars and Tunisian durum wheat cultivars (Table 3). The mean DTTI for the number of tillers was 98.5 ± 3.27%. Korean common wheat cultivars showed the highest number of tillers (109.1 ± 4.33%) followed by the Tunisian common wheat cultivars and Tunisian durum wheat cultivars (Table 3). The mean DTTI for leaf chlorophyll content was 75.3 ± 1.82%. Korean common wheat cultivars showed the highest leaf chlorophyll content (82.7 ± 4.57%), followed by the Tunisian common wheat cultivars and the Tunisian durum wheat cultivars (Table 3). Overall, DTTIs in most genotypes were <100%, except for the number of tillers in Korean common wheat cultivars.
The magnitude of DTTI at 30 days after the end of the treatment indicates the ability of plants to recover from the drought stress. At 28 days after the end of the treatment, the mean DTTI for plant height was 84.3 ± 2.04%. Tunisian common wheat cultivars showed the greatest plant height (86.9 ± 3.59%), followed by the Tunisian durum wheat cultivars and the Korean common wheat cultivars (Table 4). The mean DTTI for average leaf length was 75.5.2 ± 2.60%. Tunisian common wheat cultivars showed the highest leaf length (79.3 ± 4.03%), followed by the Korean common wheat and the Tunisian durum wheat cultivars (Table 4). The mean DTTI for the number of tillers was 132.5 ± 6.72%. Korean common wheat cultivars showed the highest number of tillers (154 ± 15.02%), followed by the Tunisian common wheat and the Tunisian durum wheat cultivars (Table 4). The mean DTTI for leaf chlorophyll content was 100.2 ± 1.24%. Tunisian durum wheat cultivars showed the highest leaf chlorophyll content (101.9 ± 2.14), followed by the Korean common wheat and Tunisian common wheat cultivars (Table 4). Compared to measurement at the end of the treatment, the mean DTTIs for plant height and average leaf length decreased, whereas those of the number of tillers per plant and leaf chlorophyll content increased.
For shoot dry weight, the mean DTTI was 84.2 ± 2.22%; the Tunisian durum wheat cultivars showed the highest shoot dry weights, followed by the Korean common wheat cultivars and Tunisian common wheat cultivars (Table 5). For days to flowering, the mean DTTI was 101.0 ± 0.35% and the Tunisian durum wheat cultivars showed the highest values, followed by the Tunisian common wheat cultivars and Korean common wheat cultivars (Table 5). Most of the shoot dry weight in the treatment was lower than in the control, whereas the days to flowering in both the treatment and the control were almost same.
Calculation of DTI and determination of drought tolerance
The magnitude of DTI indicates a combined plant response using four parameters (plant height, average leaf length, leaf chlorophyll content, and dry shoot weight) and two stages (21 days after treatment and 28 days after the end of the treatment). The average DTI of 77 wheat cultivars was 85.5%. Based on the magnitude of DTI, drought tolerance of the 77 wheat cultivars was determined as resistant lines (above 90%), moderate lines (81–90%), and susceptible lines (below 80%). From the 77 cultivars, 23 lines were resistant, 33 lines were moderate, and 21 lines were susceptible (Table 6). Four cultivars that showed >100% DTI were selected as the most resistant lines (Table 7).
SSR analysis
SSR analysis was performed to identify markers for drought tolerance. A dendrogram was constructed from the cluster analysis of similarity coefficients of SSR markers (Fig. 3). A total of 77 cultivars were classified into two groups: group A (comprised of Korean cultivars) and group B (composed of Tunisian cultivars). Groups A and B were further categorized into three clusters each. Cluster A-1 is comprised of moderate resistant and resistant lines and had average DTI of 90.9 ± 4.45%. The average DTI of cluster A-2 was 72.4 ± 5.52%, which is comprised of mostly susceptible lines and a few moderate lines. The average DTI of cluster A-3 was 92.5 ± 2.88%, which is comprised of mostly resistant lines and a few moderate lines. The average DTI of cluster B-1 was 92.5 ± 1.96%, composed mostly of resistant lines and a few of moderate lines. The average DTI of cluster B-2 was 89.7 ± 1.38%, consisted of resistant lines and moderate lines. The average DTI of cluster B-3 was 80.1 ± 1.15%, consisted of of susceptible lines and moderate lines.
This study demonstrates that wheat cultivars are sensitive to drought treatment. Plant height, average leaf length, and leaf chlorophyll content decreased, whereas the number of tillers did not change. After re-watering, plant height and average leaf length continued to decrease, whereas leaf chlorophyll content showed similar values to that of the control and the number of tillers increased. Shoot dry weight also decreased, whereas days to flowering did not change. SSR analysis showed the genetic differences between the Korean and Tunisian cultivars based on drought tolerance.
Based on morphological trait measurement, the Korean common wheat and Tunisian common and durum wheat cultivars were affected by drought stress. Plant height and average leaf length did not recover fully, decreasing at the end of treatment and at 28 days after the end of treatment. Further, drought stress resulted in a reduced shoot dry weight. Thus, drought stress may result in the inhibition of growth. According to Zhu (2001), water stress inhibits plant growth by inhibiting cell division. However, the leaf chlorophyll content of the drought-stressed plants decreased at the end of treatment, whereas it increased to levels similar to that of the control at 28 days after the end of the treatment. This indicates that the chlorophyll content of the newly produced leaves after re-watering in the treatment condition was similar to that in the control condition.
In terms of the number of tillers, Korean common wheat cultivars increased at both the end of treatment and 28 days after the end of treatment, whereas that of the Tunisian common wheat and durum wheat cultivars decreased at the end of treatment. According to Veesar et al. (2007), Indus-66, which is a more tolerant wheat genotype to water stress than other genotypes, formed a lower number of tillers. In addition, Castillo et al. (2007) reported that the number of non-productive tillers, which developed after restoration, increased with osmotic stress in rice. There might be a negative relationship between the number of non-productive tillers and drought tolerance.
Further, there was no clear difference between the control and treatment in terms of days to flowering, indicating that the number of tillers and days to flowering were not affected by drought stress. According to Foulkes et al. (2002), flowering date was typically neutral to drought stress.
Anjum et al. (2011) reported that plant height, stem diameter, and leaf area decreased under drought stress condition. These factors are related to average leaf length, and shoot dry weight. Further, there was a positive correlation between chlorophyll content (SPAD) and high transpiration efficiency, wherein SPAD could be utilized as an indicator of drought tolerance (Fotovat et al. 2007). Therefore, the calculation of DTI with morphological traits such as plant height, average leaf length, dry weight, and leaf chlorophyll weight can reflect drought tolerance.
Korean wheat and Tunisian wheat showed different DTIs at the end of treatment and 28 days after the end of treatment (Fig. 4). The DTI of Korean wheat cultivars was higher at the end of treatment than at 28 days after the end of treatment. However, the DTI of Tunisian common wheat and durum wheat cultivars were lower at the end of treatment than at 28 days after the end of treatment. This indicates that the tolerance to drought stress and the ability to restore must be considered separately. Costa et al. (1997) reported that the stress index between continuous stress and transient stress was different. Therefore, separate strategies should be used for these cultivars to improve drought tolerance.
The dendrogram showed distant relationship between the Korean and Tunisian cultivars (Fig. 3). Environmental conditions could affect genetic diversity (Li et al. 2012). Consequently, the genetic distance of Korean common wheat and Tunisian common wheat and durum wheat reflects the environmental differences between Korea and Tunisia.
In Tunisian cultivars, common wheat and durum wheat were completely mixed within the clusters, indicating that the SSR markers used in this study can be applied to both common wheat and durum wheat. In addition, both clusters A and B were categorized into some groups with drought tolerance. This suggests that the cluster analysis using SSR markers can be useful in evaluating drought tolerance in common wheat and durum wheat.
In conclusion, morphological traits and SSR markers could be used in evaluating drought tolerance in Korean and Tunisian wheat cultivars. It is necessary to establish an accurate standard to effectively evaluate tolerance to drought stress for wheat improvement. The results obtained in this study could help increase genetic resources and improve breeding programs for drought tolerance in wheat.
This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MEST) (No. 2012K1A3A1A09028123) and carried out with the support of “Cooperative Research Program for Agriculture Science & Technology Development (Project title: Development of high yielding wheat with stress tolerance via molecular breeding strategies, Project No. PJ008031)”, Rural Development Administration, Republic of Korea.
Fig. 1
Average plant height (A) and average leaf length (B) of Korean common wheat cultivars (a), Tunisian common wheat cultivars (b), and Tunisian durum wheat cultivars (c). Control (closed symbols) and treatment (open symbols).
pbb-02-139f1.jpg
Fig. 2
Average leaf chlorophyll content of Korean common wheat cultivars (a), Tunisian common wheat cultivars (b), and Tunisian durum wheat cultivars (c), and shoot dry weight of each cultivar (d).
pbb-02-139f2.jpg
Fig. 3
SSR-based genetic relationship among 77 wheat cultivars.
pbb-02-139f3.jpg
Fig. 4
Drought tolerance index (DTI) at the end of treatment and at 28 days after the end of treatment.
pbb-02-139f4.jpg
Table 1
The list of wheat cultivars used in this study.
Table 1
Entry No. Name Species Location Supplier Accession Number
1 Chunggyemil T. aestivum L. Korea NICS, RDA 01-0006-4z)
2 Olgeurumil T. aestivum L. Korea NICS, RDA 01-0006-9z)
3 Alchanmil T. aestivum L. Korea NICS, RDA 01-0006-10z)
4 Gobunmil T. aestivum L. Korea NICS, RDA 01-0006-11z)
5 Keumgangmil T. aestivum L. Korea NICS, RDA 01-0006-12z)
6 Seodunmil T. aestivum L. Korea NICS, RDA 01-0006-14z)
7 Saealmil T. aestivum L. Korea NICS, RDA 01-0006-13z)
8 Jinpummil T. aestivum L. Korea NICS, RDA 01-0006-15z)
9 Joeunmil T. aestivum L. Korea NICS, RDA 01-0006-17z)
10 Anbaekmil T. aestivum L. Korea NICS, RDA 01-0006-18z)
11 Sinmichalmil T. aestivum L. Korea NICS, RDA 01-0006-20z)
12 Jonongmil T. aestivum L. Korea NICS, RDA 01-0006-22z)
13 Jokyoungmil T. aestivum L. Korea NICS, RDA 01-0006-23z)
14 Younbaekmil T. aestivum L. Korea NICS, RDA 01-0006-24z)
15 Sukangmil T. aestivum L. Korea NICS, RDA 01-0006-29z)
16 Hanbaekmil T. aestivum L. Korea NICS, RDA 01-0006-30z)
17 Sooan T. aestivum L. Korea NICS, RDA 01-0006-33z)
18 Dajung T. aestivum L. Korea NICS, RDA 01-0006-36z)
19 Goso T. aestivum L. Korea NICS, RDA 01-0006-35z)
20 ZAAFRANE T. aestivum L. Tunisia NAC, RDA IT 205894y)
21 U14014 T. aestivum L. Tunisia NAC, RDA IT 205910y)
22 U14018 T. aestivum L. Tunisia NAC, RDA IT 205912y)
23 U14021 T. aestivum L. Tunisia NAC, RDA IT 205915y)
24 U14038 T. aestivum L. Tunisia NAC, RDA IT 205922y)
25 U14040 T. aestivum L. Tunisia NAC, RDA IT 205923y)
26 U14045 T. aestivum L. Tunisia NAC, RDA IT 205926y)
27 U14046 T. aestivum L. Tunisia NAC, RDA IT 205927y)
28 U14054 T. aestivum L. Tunisia NAC, RDA IT 205933y)
29 U14057 T. aestivum L. Tunisia NAC, RDA IT 205935y)
30 U14076 T. aestivum L. Tunisia NAC, RDA IT 205938y)
31 FRIGUI 2 T. aestivum L. Tunisia NAC, RDA IT 229475y)
32 U14010 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205908y)
33 U14031 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205917y)
34 U14050 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205929y)
35 U14053 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205932y)
36 U14055 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205934y)
37 U14078 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205940y)
38 SINLIKAT T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205941y)
39 AGIM SINLIKA T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205943y)
40 MELANGE T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205944y)
41 BEDI T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205947y)
42 Allorca T. aestivum L. Tunisia NPGS, USDA PI 41032x)
43 Florence Aurore T. aestivum L. Tunisia NPGS, USDA PI 150608x)
44 Florence Aurore T. aestivum L. Tunisia NPGS, USDA PI 150609x)
45 Koudiat A2 T. aestivum L. Tunisia NPGS, USDA PI 174665x)
46 Florence 135 T. aestivum L. Tunisia NPGS, USDA PI 185357x)
47 Mahon 73 T. aestivum L. Tunisia NPGS, USDA PI 185372x)
48 Mahon 124 T. aestivum L. Tunisia NPGS, USDA PI 185373x)
49 Roussla T. aestivum L. Tunisia NPGS, USDA PI 189775x)
50 Cailloux T. aestivum L. Tunisia NPGS, USDA PI 191446x)
51 Mahon 73 T. aestivum L. Tunisia NPGS, USDA PI 191734x)
52 Irakie 231 T. aestivum L. Tunisia NPGS, USDA PI 191738x)
53 Mahon 124 T. aestivum L. Tunisia NPGS, USDA PI 191929x)
54 Mahon 73 T. aestivum L. Tunisia NPGS, USDA PI 192024x)
55 Cailloux T. aestivum L. Tunisia NPGS, USDA PI 304915x)
56 Baroota 52 T. aestivum L. Tunisia NPGS, USDA PI 410889x)
57 Soltane T. aestivum L. Tunisia NPGS, USDA PI 428416x)
58 Ariana 66 T. aestivum L. Tunisia NPGS, USDA PI 519955x)
59 BT 2288 T. aestivum L. Tunisia NPGS, USDA PI 559656x)
60 Huguenot Bariole 360 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 174646x)
61 Jenah Retifah 24 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 184537x)
62 Mekki 13 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 185194x)
63 Sbei 7 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 185195x)
64 Ble Dur 116 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 189772x)
65 Ble Dur 870 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 189773x)
66 Jenah Retifah 1 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 192516x)
67 Jenah Retifah 24 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 192517x)
68 Sbei 272 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 278383x)
69 Mahmoudi T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 306573x)
70 Inrat 69 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 324939x)
71 Maghrebi T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 422313x)
72 Roussia T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 428434x)
73 Maghrebi 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 428462x)
74 Amal 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 433749x)
75 Badri T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 433751x)
76 Maghrebi 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 433758x)
77 Maghrebi 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 520062x)

z)The registration number of cultivar in Korea Seed & Variety Service (KSVS) (http://www.seed.go.kr).

y)The IT accession number in the RDA-Genebank Information Center (http://www.genebank.go.kr/)

x)The PI accession number in the ARS-GRIN (http://www.ars-grin.gov/).

Table 2
The list of SSR markers used in this study.
Table 2
Name F Primer R Primer Annealing Temperature (°C)
Xbarc108 GCGGGTCGTTTCCTGGAAATTCATCTAA GCGAAATGATTGGCGTTACACCTGTTG 50
Xbarc121 ACTGATCAGCAATGTCAACTGAA CCGGTGTCTTTCCTAACGCTATG 50
Xgwm573 AAGAGATAACATGCAAGAAA TTCAAATATGTGGGAACTAC 50
Xgwm130 AGCTCTGCTTCACGAGGAAG CTCCTCTTTATATCGCGTCCC 60
Xgwm332 AGCCAGCAAGTCACCAAAAC AGTGCTGGAAAGAGTAGTGAAGC 60
Xgwm635 TTCCTCACTGTAAGGGCGTT CAGCCTTAGCCTTGGCG 60
Xwmc233 GACGTCAAGAATCTTCGTCGGA ATCTGCTGAGCAGATCGTGGTT 61
Xwmc9 AACTAGTCAAATAGTCGTGTCCG GTCAAGTCATCTGACTTAACCCG 61
Xwmc596 TCAGCAACAAACATGCTCGG CCCGTGTAGGCGGTAGCTCTT 61
Xwmc603 ACAAACGGTGACAATGCAAGGA CGCCTCTCTCGTAAGCCTCAAC 61
Xwmc695 GAGGGCACCTCGTAAGTTGG GGCAGGAGCCCCTACAAGAT 61
Xwmc65 TGGATGGGAAGGAGAATAAGTG ATCCAACCGGAACTACCGTCAG 61
Xgwm260 GCCCCCTTGCACAAATC CGCAGCTACAGGAGGCC 55
Xgwm350 ACCTCATCCACATGTTCTACG GCATGGATAGGACGCCC 55
Xgwm276 ATTTGCCTGAAGAAAATATT AATTTCACTGCATACACAAG 55
Xwmc17 ACCTGCAAGAAATTAGGAACTC CTAGTGTTTCAAATATGTCGGA 51
Xwmc182 GTATCTCACGAGCATAACACAA GAAAGTGTATGGATCATTAGGC 51
Table 3
Drought tolerance trait indices (DTTIs) at 21 days after drought treatment.
Table 3
Group Plant Height (%) Average Leaf Length (%) No. of Tillers (%) Leaf Chlorophyll Content (%)
Korean common wheat 88.5 ± 3.70 94.7 ± 5.49 109.1 ± 4.33 82.7 ± 4.57
Tunisian common wheat 87.9 ± 2.67 93.6 ± 2.50 98.3 ± 6.63 76.8 ± 2.17
Tunisian durum wheat 88.7 ± 2.18 91.9 ± 2.56 91.6 ± 4.39 68.6 ± 2.74

Total 88.3 ± 1.57 93.2 ± 1.88 98.5 ± 3.27 75.3 ± 1.82
Table 4
Drought tolerance trait indices (DTTIs) at 28 days after re-watering.
Table 4
Group Plant Height (%) Average Leaf Length (%) No. of Tillers (%) Leaf Chlorophyll Content (%)
Korean common wheat 82.1 ± 4.21 76.1 ± 5.8 154 ± 15.02 100.3 ± 2.83
Tunisian common wheat 86.9 ± 3.59 79.3 ± 4.03 105.6 ± 8.24 98.5 ± 1.74
Tunisian durum wheat 83.1 ± 2.99 70.9 ± 4.11 146.8 ± 11.03 101.9 ± 2.14

Total 84.3 ± 2.04 75.5 ± 2.6 132.5 ± 6.72 100.2 ± 1.24
Table 5
Drought tolerance trait indices (DTTIs) for shoot dry weight and days to flowering.
Table 5
Group Shoot Dry Weight (%) Days to Flowering (%)
Korean common wheat 83.2 ± 6.09 100.5 ± 1.00
Tunisian common wheat 76.8 ± 3.04 100.9 ± 0.41
Tunisian durum wheat 92.7 ± 2.39 101.5 ± 0.51

Total 84.2 ± 2.22 101.0 ± 0.35
Table 6
Drought tolerance grouping of wheat cultivars based on drought tolerance index (DTI).
Table 6
Drought Tolerance Category Range of DTI No. of Cultivars Entry No. (Name)
Resistant >90% 23 1 (Chunggyemil), 4 (Gobunmil), 5 (Keumgangmil), 14 (Younbaekmil), 16 (Hanbaekmil), 17 (Sooan), 18 (Dajung), 19 (Goso), 22 (U14018), 23 (U14021), 26 (U14045), 27 (U14046), 31 (FRIGUI 2), 32 (U14010), 34 (U14050), 35 (U14053), 36 (U14055), 37 (U14078), 39 (AGIM SINLIKA), 40 (MELANGE), 41 (BEDI), 42 (Allorca), 45 (Koudiat A2)
Moderate 80–90% 33 3 (Alchanmil), 8 (Jinpummil), 10 (Anbaekmil), 11 (Sinmichalmil), 12 (Jonongmil), 13 (Jokyoungmil), 15 (Sukangmil), 20 (ZAAFRANE), 21 (U14014), 24 (U14038), 25 (U14040), 30 (U14076), 33 (U14031), 38 (SINLIKAT), 47 (Mahon 73), 48 (Mahon 124), 49 (Roussla), 50 (Cailloux), 54 (Mahon 73), 55 (Cailloux), 56 (Baroota 52), 57 (Soltane), 60 (Huguenot Bariole 360), 61 (Jenah Retifah 24), 62 (Mekki 13), 63 (Sbei 7), 64 (Ble Dur 116), 65 (Ble Dur 870), 66 (Jenah Retifah 1), 68 (Sbei 272), 71 (Maghrebi), 75 (Badri), 76 (Maghrebi 72)
Susceptible <80% 21 2 (Olgeurumil), 6 (Seodunmil), 7 (Saealmil), 9 (Joeunmil), 28 (U14054), 29 (U14057), 43 (Florence Aurore), 44 (Florence Aurore), 46 (Florence 135), 51 (Mahon 73), 52 (Irakie 231), 53 (Mahon 124), 58 (Ariana 66), 59 (BT 2288), 67 (Jenah Retifah 24), 69 (Mahmoudi), 70 (Inrat 69), 72 (Roussia), 73 (Maghrebi 72), 74 (Amal 72), 77 (Maghrebi 72)
Table 7
The most resistant cultivars to drought stress.
Table 7
Entry No. Name Group DTI (%)
14 Younbaekmil Korean common wheat 104.7
34 U14050 Tunisian durum wheat 102.6
42 Allorca Tunisian common wheat 113.6
45 Koudiat A2 Tunisian common wheat 106.8
  • Ali Z, Salam A, Azhar FM, Khan IA. 2007. Genotypic variation in salinity tolerance among spring and winter wheat (Triticum aestivum L.) accessions. South Afr J Bot. 73: 70-75.
  • Anjum SA, Xie XY, Wang LC, Saleem MF, Man C, Lei W. 2011. Morphological, physiological and biochemical responses of plants to drought stress. Afr J Agric Res. 6: 2026-2032.
  • Brown ME, Funk CC. 2008. Food security under climate change. Science. 319: 580-581.
  • Castillo EG, Tuong TP, Ismail AM, Inubushi K. 2007. Response to salinity in rice: Comparative effects of osmotic and ionic stresses. Plant Prod Sci. 10: 159-170.
  • Ciucă M, Petcu E. 2009. SSR markers associated with membrane stability in wheat (Triticum aestivum L.). Romanian Agric Res. 26: 21-24.
  • Costa LD, Vedove GD, Gianquinto G, Giovanardi R, Peressotti A. 1997. Yield, water use efficiency and nitrogen uptake in potato: influence of drought stress. Potato Res. 40: 19-34.
  • El Siddig MA, Baenziger S, Dweikat I, El Hussein AA. 2013. Preliminary screening for water stress tolerance and genetic diversity in wheat (Triticum aestivum L.) cultivars from Sudan. J Genet Eng Biotechnol. 11: 87-94.
  • Farshadfar E, Jamshidi B, Cheghamirza K, da Silva JAT. 2012. Evaluation of drought tolerance in bread wheat (Triticum aestivum L.) using in vivo and in vitro techniques. Ann Biol Res. 3: 465-476.
  • Fotovat R, Valizadeh M, Toorchi M. 2007. Association between water-use efficiency components and total chlorophyll content (SPAD) in wheat (Triticum aestivum L.) under well-watered and drought stress conditions. J Food Agric Environ. 5: 225-227.
  • Foulkes MJ, Scott RK, Sylvester-Bradley R. 2002. The ability of wheat cultivars to withstand drought in UK conditions: formation of grain yield. J Agric Sci. 138: 153-169.
  • Gupta PK, Varshney RK. 2000. The development and use of microsatellite markers for genetic analysis and plant breeding with emphasis on bread wheat. Euphytica. 113: 163-185.
  • Jaleel CA, Manivannan P, Wahid A, Farooq M, Al-Juburi HJ, Somasundaram R, Panneerselvam R. 2009. Drought stress in plants: a review on morphological characteristics and pigments composition. Int J Agric Biol. 11: 100-105.
  • Korea Seed & Variety Service. 2014. http://www.seed.go.kr/
  • Li XJ, Xu X, Yang XM, Li XQ, Liu WH, Gao AN, Li LH. 2012. Genetic diversity of the wheat landrace Youzimai from different geographic regions investigated with morphological traits, seedling resistance to powdery mildew, gliadin and microsatellite markers. Cereal Res Commun. 40: 95-106.
  • Lobell DB, Burke MB, Tebaldi C, Mastrandrea MD, Falcon WP, Naylor RL. 2008. Prioritizing climate change adaptation needs for food security in 2030. Science. 319: 607-610.
  • Munns R, James RA, Läuchli A. 2006. Approaches to increasing the salt tolerance of wheat and other cereals. J Exp Bot. 57: 1025-1043.
  • Pan XY, Wang YF, Wang GX, Cao QD, Wang J. 2002. Relationship between growth redundancy and size inequality in spring wheat population mulched with clear plastic film. Acta Phytoecol Sinica. 26: 177-184.
  • Quarrie SA, Dodig D, Pekiç S, Kirby J, Kobiljski B. 2003. Prospects for marker-assisted selection of improved drought responses in wheat. Bulg J Plant Physiol. 2003. 83-95.
  • Rai MK, Kalia RK, Singh R, Gangola MP, Dhawan AK. 2011. Developing stress tolerant plants through in vitro selection—An overview of the recent progress. Environ Exp Bot. 71: 89-98.
  • Rajaram S. 2001. Prospects and promise of wheat breeding in 21st century. Euphytica. 119: 3-15.
  • RDA. 2014. RDA-Genebank Information Center. http://www.genebank.go.kr/
  • Shahzad A, Ahmad M, Iqbal M, Ahmad I, Ali GM. 2012. Evaluation of wheat landrace genotypes for salinity tolerance at vegetative stage by using morphological and molecular markers. Genet Mol Res. 11: 679-692.
  • Takeda S, Matsuoka M. 2008. Genetic approaches to crop improvement: responding to environmental and population changes. Nat Rev Genet. 9: 444-457.
  • USDA. 2014. The Agricultural Research Service - Germplasm Resources Information Network (ARS-GRIN). http://www.ars-grin.gov/
  • USDA. 2014. The Agricultural Research Service - The GrainGenes 2.0. http://wheat.pw.usda.gov/
  • Veesar NF, Channa AN, Rind MJ, Larik AS. 2007. Influence of water stress imposed at different stages on growth and yield attributes in bread wheat genotypes Triticum aestivum L. Wheat Inform Ser. 104: 15-19.
  • Yıldırıma M, Kılıçb H, Kendalb E, Karahan T. 2011. Applicability of chlorophyll meter readings as yield predictor in durum wheat. JPlant Nutri. 34: 151-164.
  • Zhu JK. 2001. Plant salt tolerance. Trends Plant Sci. 6: 66-71.

Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:

Include:

Phenotypic and Genotypic Analyses of Drought Tolerance in Korean and Tunisian Wheat Cultivars
Plant Breed. Biotech.. 2014;2(2):139-150.   Published online June 30, 2014
Download Citation

Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

Format:
Include:
Phenotypic and Genotypic Analyses of Drought Tolerance in Korean and Tunisian Wheat Cultivars
Plant Breed. Biotech.. 2014;2(2):139-150.   Published online June 30, 2014
Close

Figure

  • 0
  • 1
  • 2
  • 3
Phenotypic and Genotypic Analyses of Drought Tolerance in Korean and Tunisian Wheat Cultivars
Image Image Image Image
Fig. 1 Average plant height (A) and average leaf length (B) of Korean common wheat cultivars (a), Tunisian common wheat cultivars (b), and Tunisian durum wheat cultivars (c). Control (closed symbols) and treatment (open symbols).
Fig. 2 Average leaf chlorophyll content of Korean common wheat cultivars (a), Tunisian common wheat cultivars (b), and Tunisian durum wheat cultivars (c), and shoot dry weight of each cultivar (d).
Fig. 3 SSR-based genetic relationship among 77 wheat cultivars.
Fig. 4 Drought tolerance index (DTI) at the end of treatment and at 28 days after the end of treatment.
Phenotypic and Genotypic Analyses of Drought Tolerance in Korean and Tunisian Wheat Cultivars

The list of wheat cultivars used in this study.

Entry No. Name Species Location Supplier Accession Number
1 Chunggyemil T. aestivum L. Korea NICS, RDA 01-0006-4z)
2 Olgeurumil T. aestivum L. Korea NICS, RDA 01-0006-9z)
3 Alchanmil T. aestivum L. Korea NICS, RDA 01-0006-10z)
4 Gobunmil T. aestivum L. Korea NICS, RDA 01-0006-11z)
5 Keumgangmil T. aestivum L. Korea NICS, RDA 01-0006-12z)
6 Seodunmil T. aestivum L. Korea NICS, RDA 01-0006-14z)
7 Saealmil T. aestivum L. Korea NICS, RDA 01-0006-13z)
8 Jinpummil T. aestivum L. Korea NICS, RDA 01-0006-15z)
9 Joeunmil T. aestivum L. Korea NICS, RDA 01-0006-17z)
10 Anbaekmil T. aestivum L. Korea NICS, RDA 01-0006-18z)
11 Sinmichalmil T. aestivum L. Korea NICS, RDA 01-0006-20z)
12 Jonongmil T. aestivum L. Korea NICS, RDA 01-0006-22z)
13 Jokyoungmil T. aestivum L. Korea NICS, RDA 01-0006-23z)
14 Younbaekmil T. aestivum L. Korea NICS, RDA 01-0006-24z)
15 Sukangmil T. aestivum L. Korea NICS, RDA 01-0006-29z)
16 Hanbaekmil T. aestivum L. Korea NICS, RDA 01-0006-30z)
17 Sooan T. aestivum L. Korea NICS, RDA 01-0006-33z)
18 Dajung T. aestivum L. Korea NICS, RDA 01-0006-36z)
19 Goso T. aestivum L. Korea NICS, RDA 01-0006-35z)
20 ZAAFRANE T. aestivum L. Tunisia NAC, RDA IT 205894y)
21 U14014 T. aestivum L. Tunisia NAC, RDA IT 205910y)
22 U14018 T. aestivum L. Tunisia NAC, RDA IT 205912y)
23 U14021 T. aestivum L. Tunisia NAC, RDA IT 205915y)
24 U14038 T. aestivum L. Tunisia NAC, RDA IT 205922y)
25 U14040 T. aestivum L. Tunisia NAC, RDA IT 205923y)
26 U14045 T. aestivum L. Tunisia NAC, RDA IT 205926y)
27 U14046 T. aestivum L. Tunisia NAC, RDA IT 205927y)
28 U14054 T. aestivum L. Tunisia NAC, RDA IT 205933y)
29 U14057 T. aestivum L. Tunisia NAC, RDA IT 205935y)
30 U14076 T. aestivum L. Tunisia NAC, RDA IT 205938y)
31 FRIGUI 2 T. aestivum L. Tunisia NAC, RDA IT 229475y)
32 U14010 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205908y)
33 U14031 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205917y)
34 U14050 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205929y)
35 U14053 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205932y)
36 U14055 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205934y)
37 U14078 T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205940y)
38 SINLIKAT T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205941y)
39 AGIM SINLIKA T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205943y)
40 MELANGE T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205944y)
41 BEDI T. turgidum L. subsp. Durum Tunisia NAC, RDA IT 205947y)
42 Allorca T. aestivum L. Tunisia NPGS, USDA PI 41032x)
43 Florence Aurore T. aestivum L. Tunisia NPGS, USDA PI 150608x)
44 Florence Aurore T. aestivum L. Tunisia NPGS, USDA PI 150609x)
45 Koudiat A2 T. aestivum L. Tunisia NPGS, USDA PI 174665x)
46 Florence 135 T. aestivum L. Tunisia NPGS, USDA PI 185357x)
47 Mahon 73 T. aestivum L. Tunisia NPGS, USDA PI 185372x)
48 Mahon 124 T. aestivum L. Tunisia NPGS, USDA PI 185373x)
49 Roussla T. aestivum L. Tunisia NPGS, USDA PI 189775x)
50 Cailloux T. aestivum L. Tunisia NPGS, USDA PI 191446x)
51 Mahon 73 T. aestivum L. Tunisia NPGS, USDA PI 191734x)
52 Irakie 231 T. aestivum L. Tunisia NPGS, USDA PI 191738x)
53 Mahon 124 T. aestivum L. Tunisia NPGS, USDA PI 191929x)
54 Mahon 73 T. aestivum L. Tunisia NPGS, USDA PI 192024x)
55 Cailloux T. aestivum L. Tunisia NPGS, USDA PI 304915x)
56 Baroota 52 T. aestivum L. Tunisia NPGS, USDA PI 410889x)
57 Soltane T. aestivum L. Tunisia NPGS, USDA PI 428416x)
58 Ariana 66 T. aestivum L. Tunisia NPGS, USDA PI 519955x)
59 BT 2288 T. aestivum L. Tunisia NPGS, USDA PI 559656x)
60 Huguenot Bariole 360 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 174646x)
61 Jenah Retifah 24 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 184537x)
62 Mekki 13 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 185194x)
63 Sbei 7 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 185195x)
64 Ble Dur 116 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 189772x)
65 Ble Dur 870 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 189773x)
66 Jenah Retifah 1 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 192516x)
67 Jenah Retifah 24 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 192517x)
68 Sbei 272 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 278383x)
69 Mahmoudi T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 306573x)
70 Inrat 69 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 324939x)
71 Maghrebi T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 422313x)
72 Roussia T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 428434x)
73 Maghrebi 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 428462x)
74 Amal 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 433749x)
75 Badri T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 433751x)
76 Maghrebi 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 433758x)
77 Maghrebi 72 T. turgidum L. subsp. Durum Tunisia NPGS, USDA PI 520062x)

z)The registration number of cultivar in Korea Seed & Variety Service (KSVS) (http://www.seed.go.kr).

y)The IT accession number in the RDA-Genebank Information Center (http://www.genebank.go.kr/)

x)The PI accession number in the ARS-GRIN (http://www.ars-grin.gov/).

The list of SSR markers used in this study.

Name F Primer R Primer Annealing Temperature (°C)
Xbarc108 GCGGGTCGTTTCCTGGAAATTCATCTAA GCGAAATGATTGGCGTTACACCTGTTG 50
Xbarc121 ACTGATCAGCAATGTCAACTGAA CCGGTGTCTTTCCTAACGCTATG 50
Xgwm573 AAGAGATAACATGCAAGAAA TTCAAATATGTGGGAACTAC 50
Xgwm130 AGCTCTGCTTCACGAGGAAG CTCCTCTTTATATCGCGTCCC 60
Xgwm332 AGCCAGCAAGTCACCAAAAC AGTGCTGGAAAGAGTAGTGAAGC 60
Xgwm635 TTCCTCACTGTAAGGGCGTT CAGCCTTAGCCTTGGCG 60
Xwmc233 GACGTCAAGAATCTTCGTCGGA ATCTGCTGAGCAGATCGTGGTT 61
Xwmc9 AACTAGTCAAATAGTCGTGTCCG GTCAAGTCATCTGACTTAACCCG 61
Xwmc596 TCAGCAACAAACATGCTCGG CCCGTGTAGGCGGTAGCTCTT 61
Xwmc603 ACAAACGGTGACAATGCAAGGA CGCCTCTCTCGTAAGCCTCAAC 61
Xwmc695 GAGGGCACCTCGTAAGTTGG GGCAGGAGCCCCTACAAGAT 61
Xwmc65 TGGATGGGAAGGAGAATAAGTG ATCCAACCGGAACTACCGTCAG 61
Xgwm260 GCCCCCTTGCACAAATC CGCAGCTACAGGAGGCC 55
Xgwm350 ACCTCATCCACATGTTCTACG GCATGGATAGGACGCCC 55
Xgwm276 ATTTGCCTGAAGAAAATATT AATTTCACTGCATACACAAG 55
Xwmc17 ACCTGCAAGAAATTAGGAACTC CTAGTGTTTCAAATATGTCGGA 51
Xwmc182 GTATCTCACGAGCATAACACAA GAAAGTGTATGGATCATTAGGC 51

Drought tolerance trait indices (DTTIs) at 21 days after drought treatment.

Group Plant Height (%) Average Leaf Length (%) No. of Tillers (%) Leaf Chlorophyll Content (%)
Korean common wheat 88.5 ± 3.70 94.7 ± 5.49 109.1 ± 4.33 82.7 ± 4.57
Tunisian common wheat 87.9 ± 2.67 93.6 ± 2.50 98.3 ± 6.63 76.8 ± 2.17
Tunisian durum wheat 88.7 ± 2.18 91.9 ± 2.56 91.6 ± 4.39 68.6 ± 2.74

Total 88.3 ± 1.57 93.2 ± 1.88 98.5 ± 3.27 75.3 ± 1.82

Drought tolerance trait indices (DTTIs) at 28 days after re-watering.

Group Plant Height (%) Average Leaf Length (%) No. of Tillers (%) Leaf Chlorophyll Content (%)
Korean common wheat 82.1 ± 4.21 76.1 ± 5.8 154 ± 15.02 100.3 ± 2.83
Tunisian common wheat 86.9 ± 3.59 79.3 ± 4.03 105.6 ± 8.24 98.5 ± 1.74
Tunisian durum wheat 83.1 ± 2.99 70.9 ± 4.11 146.8 ± 11.03 101.9 ± 2.14

Total 84.3 ± 2.04 75.5 ± 2.6 132.5 ± 6.72 100.2 ± 1.24

Drought tolerance trait indices (DTTIs) for shoot dry weight and days to flowering.

Group Shoot Dry Weight (%) Days to Flowering (%)
Korean common wheat 83.2 ± 6.09 100.5 ± 1.00
Tunisian common wheat 76.8 ± 3.04 100.9 ± 0.41
Tunisian durum wheat 92.7 ± 2.39 101.5 ± 0.51

Total 84.2 ± 2.22 101.0 ± 0.35

Drought tolerance grouping of wheat cultivars based on drought tolerance index (DTI).

Drought Tolerance Category Range of DTI No. of Cultivars Entry No. (Name)
Resistant >90% 23 1 (Chunggyemil), 4 (Gobunmil), 5 (Keumgangmil), 14 (Younbaekmil), 16 (Hanbaekmil), 17 (Sooan), 18 (Dajung), 19 (Goso), 22 (U14018), 23 (U14021), 26 (U14045), 27 (U14046), 31 (FRIGUI 2), 32 (U14010), 34 (U14050), 35 (U14053), 36 (U14055), 37 (U14078), 39 (AGIM SINLIKA), 40 (MELANGE), 41 (BEDI), 42 (Allorca), 45 (Koudiat A2)
Moderate 80–90% 33 3 (Alchanmil), 8 (Jinpummil), 10 (Anbaekmil), 11 (Sinmichalmil), 12 (Jonongmil), 13 (Jokyoungmil), 15 (Sukangmil), 20 (ZAAFRANE), 21 (U14014), 24 (U14038), 25 (U14040), 30 (U14076), 33 (U14031), 38 (SINLIKAT), 47 (Mahon 73), 48 (Mahon 124), 49 (Roussla), 50 (Cailloux), 54 (Mahon 73), 55 (Cailloux), 56 (Baroota 52), 57 (Soltane), 60 (Huguenot Bariole 360), 61 (Jenah Retifah 24), 62 (Mekki 13), 63 (Sbei 7), 64 (Ble Dur 116), 65 (Ble Dur 870), 66 (Jenah Retifah 1), 68 (Sbei 272), 71 (Maghrebi), 75 (Badri), 76 (Maghrebi 72)
Susceptible <80% 21 2 (Olgeurumil), 6 (Seodunmil), 7 (Saealmil), 9 (Joeunmil), 28 (U14054), 29 (U14057), 43 (Florence Aurore), 44 (Florence Aurore), 46 (Florence 135), 51 (Mahon 73), 52 (Irakie 231), 53 (Mahon 124), 58 (Ariana 66), 59 (BT 2288), 67 (Jenah Retifah 24), 69 (Mahmoudi), 70 (Inrat 69), 72 (Roussia), 73 (Maghrebi 72), 74 (Amal 72), 77 (Maghrebi 72)

The most resistant cultivars to drought stress.

Entry No. Name Group DTI (%)
14 Younbaekmil Korean common wheat 104.7
34 U14050 Tunisian durum wheat 102.6
42 Allorca Tunisian common wheat 113.6
45 Koudiat A2 Tunisian common wheat 106.8
Table 1 The list of wheat cultivars used in this study.

The registration number of cultivar in Korea Seed & Variety Service (KSVS) (http://www.seed.go.kr).

The IT accession number in the RDA-Genebank Information Center (http://www.genebank.go.kr/)

The PI accession number in the ARS-GRIN (http://www.ars-grin.gov/).

Table 2 The list of SSR markers used in this study.
Table 3 Drought tolerance trait indices (DTTIs) at 21 days after drought treatment.
Table 4 Drought tolerance trait indices (DTTIs) at 28 days after re-watering.
Table 5 Drought tolerance trait indices (DTTIs) for shoot dry weight and days to flowering.
Table 6 Drought tolerance grouping of wheat cultivars based on drought tolerance index (DTI).
Table 7 The most resistant cultivars to drought stress.